Expression of PEI-coated gold nanoparticles carrying exogenous gene in periwinkle mesophyll cells and its practice in huanglongbing research

Zhang, Junzhe; Lei, Wenxue; Yang, Meng; Zhou, Chengqian; Zhang, Baihong; Yuan, Jun; Wang, Min; Xu, Dongqing; Meng, Xiangchun; Chen, Wenli

doi:10.1016/j.isci.2022.104479

Cited by 16 publications

(9 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As previously described (Lei et al ., 2020; Zhang et al ., 2022; Zhang et al ., 2023), 1 mM gold nanoparticles (AuNPs) were synthesized. The artificial microRNA (amiRNA) ATG6 (UCAAUUCUAGGAUAACUGCCC) was designed based on the Web MicroRNA Designer (http://wmd3.weigelworld.org/) platform.…”

Section: Methodsmentioning

confidence: 99%

“…Protein extraction and western blotting were performed as previously described (Lei et al ., 2020; Zhang et al ., 2022). Protein was denatured at 100°C for 10 mins.…”

Section: Methodsmentioning

confidence: 99%

“…Total RNA was extracted from Arabidopsis (100 mg) using Trizol RNA reagent (Invitrogen, 10296-028, Waltham, MA, USA). RT-qPCR assays were performed as previously described (Zhang et al ., 2018; Zhang et al ., 2022). All primers for RT-qPCR are listed individually in Table S5 of Supplemental Data 1.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

ATG6 interacting with NPR1 increasesArabidopsis thalianaresistance toPstDC3000/avrRps4by increasing its nuclear accumulation and stability

Zhang,

Huang,

Guo

et al. 2024

Preprint

Self Cite

View full text Add to dashboard Cite

Autophagy-related gene 6 (ATG6) plays a crucial role in plant immunity. Nonexpressor of pathogenesis-related genes1 (NPR1) acts as a signaling hub of plant immunity. However, the relationship between ATG6 and NPR1 is unclear. Here, we find that ATG6 directly interacts with NPR1.ATG6overexpression significantly increased nuclear accumulation of NPR1. Furthermore, we demonstrate thatATG6increases NPR1 protein levels and improves its stability. Interestingly, ATG6 promotes the formation of SINCs (SA-induced NPR1 condensates)-like condensates. Additionally, ATG6 and NPR1 synergistically promote the expression ofpathogenesis-relatedgenes. Further results showed that silencingATG6inNPR1-GFPexacerbatesPstDC3000/avrRps4invasion, while double overexpression ofATG6andNPR1synergistically inhibitsPstDC3000/avrRps4invasion. In summary, our findings unveil an interplay of NPR1 with ATG6 and elucidate important molecular mechanisms for enhancing plant immunity.HighlightWe unveil a novel relationship in which ATG6 positively regulates NPR1 in plant immunity.

show abstract

Section: Methodsmentioning

confidence: 99%

“…Protein extraction and western blotting were performed as previously described (Lei et al ., 2020; Zhang et al ., 2022). Protein was denatured at 100°C for 10 mins.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

ATG6 interacting with NPR1 increasesArabidopsis thalianaresistance toPstDC3000/avrRps4by increasing its nuclear accumulation and stability

Zhang,

Huang,

Guo

et al. 2024

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…In addition, cellular uptake can be facilitated by the addition of cationic polymers ( Kim et al, 2005 ). X. Zhang et al ( Zhang, 2022a ) prepared PP/PEI nano complexes by coupling poly (ethylene glycol) methyl ether block-PLGA (PEG-b-PLGA; PP) nanoparticle surfaces with PEI, and PP/PEI would carry the CRISPR/Cas9 gene editing plasmid induced efficient genome editing in endothelial cells of the vascular system (including lungs, heart, aorta, and peripheral vasculature) of adult mice after intravenous injection. In addition, the gene editing plasmid can induce genome editing of at least two genes at the same time or introduce both genome editing and transgene expression in vascular endothelial cells, advancing the development of cardiovascular research and potential gene therapy.…”

Section: Application Of Non-viral Vectors In Cardiovascular Diseasesmentioning

confidence: 99%

Nanotechnology-based non-viral vectors for gene delivery in cardiovascular diseases

Jiao,

Sun,

Sun

et al. 2024

Front. Bioeng. Biotechnol.

View full text Add to dashboard Cite

Gene therapy is a technique that rectifies defective or abnormal genes by introducing exogenous genes into target cells to cure the disease. Although gene therapy has gained some accomplishment for the diagnosis and therapy of inherited or acquired cardiovascular diseases, how to efficiently and specifically deliver targeted genes to the lesion sites without being cleared by the blood system remains challenging. Based on nanotechnology development, the non-viral vectors provide a promising strategy for overcoming the difficulties in gene therapy. At present, according to the physicochemical properties, nanotechnology-based non-viral vectors include polymers, liposomes, lipid nanoparticles, and inorganic nanoparticles. Non-viral vectors have an advantage in safety, efficiency, and easy production, possessing potential clinical application value when compared with viral vectors. Therefore, we summarized recent research progress of gene therapy for cardiovascular diseases based on commonly used non-viral vectors, hopefully providing guidance and orientation for future relevant research.

show abstract

“…Furthermore, PEI or PEI-coated nanomaterials can cross plant cellular barriers and localize in the cytosol or organelles, as it was demonstrated both in vitro , and in vivo studies. Particularly, PEI has been used as carrier to deliver plasmids to plants for transient gene expression, as well as to deliver small interfering RNA, siRNA, for gene silencing . PEI’s high positive charge condensates negatively charged polynucleotides and, at the same time, protects them from degradation, thus improving transfection efficiency.…”

mentioning

confidence: 99%

Chitosan-Modified Polyethyleneimine Nanoparticles for Enhancing the Carboxylation Reaction and Plants’ CO₂Uptake

et al. 2023

View full text Add to dashboard Cite

Increasing plants' photosynthetic efficiency is a major challenge that must be addressed in order to cover the food demands of the growing population in the changing climate. Photosynthesis is greatly limited at the initial carboxylation reaction, where CO 2 is converted to the organic acid 3-PGA, catalyzed by the RuBisCO enzyme. RuBisCO has poor affinity for CO 2 , but also the CO 2 concentration at the RuBisCO site is limited by the diffusion of atmospheric CO 2 through the various leaf compartments to the reaction site. Beyond genetic engineering, nanotechnology can offer a materials-based approach for enhancing photosynthesis, and yet, it has mostly been explored for the light-dependent reactions. In this work, we developed polyethyleneimine-based nanoparticles for enhancing the carboxylation reaction. We demonstrate that the nanoparticles can capture CO 2 in the form of bicarbonate and increase the CO 2 that reacts with the RuBisCO enzyme, enhancing the 3-PGA production in in vitro assays by 20%. The nanoparticles can be introduced to the plant via leaf infiltration and, because of the functionalization with chitosan oligomers, they do not induce any toxic effect to the plant. In the leaves, the nanoparticles localize in the apoplastic space but also spontaneously reach the chloroplasts where photosynthetic activity takes place. Their CO 2 loading-dependent fluorescence verifies that, in vivo, they maintain their ability to capture CO 2 and can be therefore reloaded with atmospheric CO 2 while in planta. Our results contribute to the development of a nanomaterials-based CO 2 -concentrating mechanism in plants that can potentially increase photosynthetic efficiency and overall plants' CO 2 storage.

show abstract

Expression of PEI-coated gold nanoparticles carrying exogenous gene in periwinkle mesophyll cells and its practice in huanglongbing research

Cited by 16 publications

References 43 publications

ATG6 interacting with NPR1 increasesArabidopsis thalianaresistance toPstDC3000/avrRps4by increasing its nuclear accumulation and stability

ATG6 interacting with NPR1 increasesArabidopsis thalianaresistance toPstDC3000/avrRps4by increasing its nuclear accumulation and stability

Nanotechnology-based non-viral vectors for gene delivery in cardiovascular diseases

Chitosan-Modified Polyethyleneimine Nanoparticles for Enhancing the Carboxylation Reaction and Plants’ CO₂Uptake

Contact Info

Product

Resources

About

Expression of PEI-coated gold nanoparticles carrying exogenous gene in periwinkle mesophyll cells and its practice in huanglongbing research

Cited by 16 publications

References 43 publications

ATG6 interacting with NPR1 increasesArabidopsis thalianaresistance toPstDC3000/avrRps4by increasing its nuclear accumulation and stability

ATG6 interacting with NPR1 increasesArabidopsis thalianaresistance toPstDC3000/avrRps4by increasing its nuclear accumulation and stability

Nanotechnology-based non-viral vectors for gene delivery in cardiovascular diseases

Chitosan-Modified Polyethyleneimine Nanoparticles for Enhancing the Carboxylation Reaction and Plants’ CO2Uptake

Contact Info

Product

Resources

About

Chitosan-Modified Polyethyleneimine Nanoparticles for Enhancing the Carboxylation Reaction and Plants’ CO₂Uptake