Expression profile of the sphingosine kinase signalling system in the lung of patients with chronic obstructive pulmonary disease

Cordts, Fabian; Pitson, Stuart M.; Tabeling, Christoph; Gibbins, Ian L.; Moffat, David; Jersmann, Hubertus; Hodge, Sandra; Haberberger, Rainer Viktor

doi:10.1016/j.lfs.2011.08.018

Cited by 29 publications

(27 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The following human primer pairs were used as follows: forward primer (5′‐TGCGGGAAGGGAGTATGTTT ‐3′) and reverse primer (5′‐CGATGGCGAGGAGACTGAAC ‐3′) for S1P1(van Doorn et al., 2012); forward primer (5′‐ TCTCTACGCCAAGCATTATGTGC ‐3′) and reverse primer (5′‐ TGGCCAACAGGATGATGGA ‐3′) for S1P2(van Doorn et al., 2012); forward primer (5′‐ TGCAGCTTCATCGTCTTGGAG ‐3′) and reverse primer (5′‐ GCCAATGAAAAAGTACATGCGG ‐3′) for S1P3 (van Doorn et al., 2012); forward primer (5′‐ CTGCTCTTCACCGCCCTGGC ‐3′) and reverse primer (5′‐ GAAGCCGTAGACGCGGCTGG ‐3′) for S1P4 (Cordts et al., 2011); forward primer (5′‐ GTGAGGTGGGAGCCATAGAA ‐3′) and reverse primer (5′‐ TTGGCTGAGTCTCCCAGAGT ‐3′) for S1P5 (Cordts et al., 2011). …”

Section: Methodsmentioning

confidence: 99%

Fingolimod promotes blood–nerve barrier properties in vitro

et al. 2018

View full text Add to dashboard Cite

ObjectiveThe main effect of fingolimod is thought to be functional antagonism of lymphocytic S1P1 receptors and the prevention of lymphocyte egress from lymphoid tissues, thereby reducing lymphocyte infiltration into the nervous system. However, a growing number of reports suggest that fingolimod also has a direct effect on several cell types in the nervous system. Although we previously reported that fingolimod enhances blood–brain barrier (BBB) functions, there have been no investigations regarding the blood–nerve barrier (BNB). In this study, we examine how fingolimod affects the BNB.MethodsAn immortalized human peripheral nerve microvascular endothelial cell line (HPnMEC) was used to evaluate BNB barrier properties. We examined tight junction proteins and barrier functions of HPnMECs in conditioned medium with or without fingolimod‐phosphate and blood sera from patients with typical chronic inflammatory demyelinating polyneuropathy (CIDP).ResultsIncubation with fingolimod‐phosphate increased levels of claudin‐5 mRNA and protein as well as TEER values in HPnMECs. Conversely, typical CIDP sera decreased claudin‐5 mRNA/protein levels and TEER values in HPnMECs; however, pretreatment with fingolimod‐phosphate inhibited the effects of the typical CIDP sera.ConclusionsFingolimod‐phosphate directly modifies the BNB and enhances barrier properties. This mechanism may be a viable therapeutic target for CIDP, and fingolimod may be useful in patients with typical CIDP who have severe barrier disruption.

show abstract

Section: Methodsmentioning

confidence: 99%

Fingolimod promotes blood–nerve barrier properties in vitro

et al. 2018

View full text Add to dashboard Cite

show abstract

“…S1P is generated by conversion of ceramide to sphingosine and its subsequent phosphorylation by sphingosine kinase (SphK) (25), which is known to be up-regulated upon hypoxia (26). In the lung, SphK1 is the predominant SphK isoform (27) and has been shown to modulate pulmonary vascular responsiveness and remodeling (28). S1P acts intracellularly as a second messenger or extracellularly via activation of five G protein-coupled receptors (GPCRs) termed S1P [1][2][3][4][5] (25), of which S1P 2 (29) and S1P 4 (30) mediate pulmonary vasoconstriction.…”

Section: Significancementioning

confidence: 99%

CFTR and sphingolipids mediate hypoxic pulmonary vasoconstriction

Tabeling¹,

Wang

et al. 2015

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

Hypoxic pulmonary vasoconstriction (HPV) optimizes pulmonary ventilation-perfusion matching in regional hypoxia, but promotes pulmonary hypertension in global hypoxia. Ventilation-perfusion mismatch is a major cause of hypoxemia in cystic fibrosis. We hypothesized that cystic fibrosis transmembrane conductance regulator (CFTR) may be critical in HPV, potentially by modulating the response to sphingolipids as mediators of HPV. HPV and ventilation-perfusion mismatch were analyzed in isolated mouse lungs or in vivo. Ca 2+ mobilization and transient receptor potential canonical 6 (TRPC6) translocation were studied in human pulmonary (PASMCs) or coronary (CASMCs) artery smooth muscle cells. CFTR inhibition or deficiency diminished HPV and aggravated ventilation-perfusion mismatch. In PASMCs, hypoxia caused CFTR to interact with TRPC6, whereas CFTR inhibition attenuated hypoxiainduced TRPC6 translocation to caveolae and Ca 2+ mobilization. Ca 2+ mobilization by sphingosine-1-phosphate (S1P) was also attenuated by CFTR inhibition in PASMCs, but amplified in CASMCs. Inhibition of neutral sphingomyelinase (nSMase) blocked HPV, whereas exogenous nSMase caused TRPC6 translocation and vasoconstriction that were blocked by CFTR inhibition. nSMase-and hypoxia-induced vasoconstriction, yet not TRPC6 translocation, were blocked by inhibition or deficiency of sphingosine kinase 1 (SphK1) or antagonism of S1P receptors 2 and 4 (S1P 2/4 ). S1P and nSMase had synergistic effects on pulmonary vasoconstriction that involved TRPC6, phospholipase C, and rho kinase. Our findings demonstrate a central role of CFTR and sphingolipids in HPV. Upon hypoxia, nSMase triggers TRPC6 translocation, which requires its interaction with CFTR. Concomitant SphK1-dependent formation of S1P and activation of S1P 2/4 result in phospholipase C-mediated TRPC6 and rho kinase activation, which conjointly trigger vasoconstriction.

show abstract

“…Smokers (10) and patients with COPD (11) have increased ceramides in their lungs, and ceramides have been implicated in tobacco smoke-induced pulmonary vascular cell apoptosis (12) and clearance of apoptotic cells by alveolar macrophages (13). S1P receptor 5 expression is reduced the lungs of patients with COPD (14), and S1P analogs inhibit emphysema development in animal models (15). Recently, in a small cohort, sphingolipids were found elevated in the sputum in COPD (6).…”

mentioning

confidence: 99%

Plasma Sphingolipids Associated with Chronic Obstructive Pulmonary Disease Phenotypes

Bowler

Jacobson

Cruickshank

et al. 2015

Am J Respir Crit Care Med

143

127

View full text Add to dashboard Cite

Rationale: Chronic obstructive pulmonary disease (COPD) occurs in a minority of smokers and is characterized by intermittent exacerbations and clinical subphenotypes such as emphysema and chronic bronchitis. Although sphingolipids as a class are implicated in the pathogenesis of COPD, the particular sphingolipid species associated with COPD subphenotypes remain unknown.Objectives: To use mass spectrometry to determine which plasma sphingolipids are associated with subphenotypes of COPD.Methods: One hundred twenty-nine current and former smokers from the COPDGene cohort had 69 distinct sphingolipid species detected in plasma by targeted mass spectrometry. Of these, 23 were also measured in 131 plasma samples (117 independent subjects) using an untargeted platform in an independent laboratory. Regression analysis with adjustment for clinical covariates, correction for false discovery rate, and metaanalysis were used to test associations between COPD subphenotypes and sphingolipids. Peripheral blood mononuclear cells were used to test associations between sphingolipid gene expression and plasma sphingolipids.Measurements and Main Results: Of the measured plasma sphingolipids, five sphingomyelins were associated with emphysema; four trihexosylceramides and three dihexosylceramides were associated with COPD exacerbations. Three sphingolipids were strongly associated with sphingolipid gene expression, and 15 sphingolipid gene/metabolite pairs were differentially regulated between COPD cases and control subjects.Conclusions: There is evidence of systemic dysregulation of sphingolipid metabolism in patients with COPD. Subphenotyping suggests that sphingomyelins are strongly associated with emphysema and glycosphingolipids are associated with COPD exacerbations.

show abstract

Expression profile of the sphingosine kinase signalling system in the lung of patients with chronic obstructive pulmonary disease

Cited by 29 publications

References 44 publications

Fingolimod promotes blood–nerve barrier properties in vitro

Fingolimod promotes blood–nerve barrier properties in vitro

CFTR and sphingolipids mediate hypoxic pulmonary vasoconstriction

Plasma Sphingolipids Associated with Chronic Obstructive Pulmonary Disease Phenotypes

Contact Info

Product

Resources

About