Factors affecting the leukotoxin activity of Fusobacterium necrophorum

Tan, Z L; Nagaraja, T. G.; Chengappa, M. M.

doi:10.1016/0378-1135(92)90003-c

Cited by 48 publications

(47 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The bacterium is an aerotolerant anaerobe (Tan et al, 1992). Fusobacterium necrophorum has also been identified as the primary pathogen in necrotic laryngitis (calf diphtheria) and in foot rot and foot abscesses in cattle (Emery et al, 1985;Tan et al, 1996).…”

Section: Fusobacterium Necrophorummentioning

confidence: 99%

“…Subsp. necrophorum produces more leukotoxin than funduliforme (Coyle-Dennis and Lauerman, 1979;Emery et al, 1985;Tan et al, 1992), and isolates from liver abscesses tend to be more leukotoxic than isolates from the rumen, indicating a selective advantage for high-leukotoxin-producing strains to survive in the ruminal epithelium and in the liver parenchymal tissue (Tan et al, 1994). Leukotoxin is encoded by a gene designated as lktA, which is the second gene in a 3-gene operon of lktB, lktA, and lktC (Narayanan et al, 2001).…”

Section: Fusobacterium Necrophorummentioning

confidence: 99%

See 1 more Smart Citation

Liver abscesses in cattle: A review of incidence in Holsteins and of bacteriology and vaccine approaches to control in feedlot cattle12

Amachawadi

Nagaraja

2016

Journal of Animal Science

114

View full text Add to dashboard Cite

2 Adapted from Rezac et al. (2014b). Data collected at commercial packing plants in Kansas and Texas. 3 Adapted from Rezac et al. (2014a). Data collected at a commercial packing plant in the Great Lakes region.4 Normal = Liver free from abscesses; A-= Liver with 1 to 2 small abscesses; A = Liver with 2 to 4 large abscesses or multiple small abscesses; A+ = Liver with multiple large abscesses, abscesses adhered to diaphragm, abdominal organs or both, or open or ruptured abscesses.5 Numbers in parentheses are percentage of total abscesses.

show abstract

Section: Fusobacterium Necrophorummentioning

confidence: 99%

Section: Fusobacterium Necrophorummentioning

confidence: 99%

Liver abscesses in cattle: A review of incidence in Holsteins and of bacteriology and vaccine approaches to control in feedlot cattle12

Amachawadi

Nagaraja

2016

Journal of Animal Science

114

View full text Add to dashboard Cite

show abstract

“…Bovine peripheral PMNs were prepared as previously described. 25 Purified leukocytes were washed twice and resuspended in 0.01 M phosphate buffered saline. Viable cell concentration was determined with a hemocytometer by the trypan blue dye exclusion method.…”

Section: Leukotoxicity Assay By Flow Cytometrymentioning

confidence: 99%

“…Viable cell concentration was determined with a hemocytometer by the trypan blue dye exclusion method. 25 Approximately 2 × 10 6 PMNs were placed into sterile 5-ml polystyrene culture tubes and incubated with an equal volume of filter-sterilized culture supernatant. Cells were incubated for 45 min at 37°C and 5% CO 2 , washed twice, and resuspended in phosphate buffered saline.…”

Section: Leukotoxicity Assay By Flow Cytometrymentioning

confidence: 99%

Characterization of Fusobacterium isolates from the respiratory tract of white-tailed deer (Odocoileus virginianus)

et al. 2014

View full text Add to dashboard Cite

Abstract.A total of 23 clinical isolates of Fusobacterium spp. were recovered at necropsy over a 2-year period from the respiratory tract of white-tailed deer (Odocoileus virginianus). Isolates were identified as Fusobacterium varium (18/23), Fusobacterium necrophorum subsp. funduliforme (3/23), and Fusobacterium necrophorum subsp. necrophorum (2/23). Using polymerase chain reaction-based detection of virulence genes, all F. necrophorum isolates were positive for the promoter region of the leukotoxin operon and the hemagglutinin-related protein gene, while all F. varium isolates were negative. The presence of the leukotoxin gene in F. necrophorum isolates and the absence of this gene in F. varium isolates were confirmed by Southern hybridization using 2 separate probes. Toxicity to bovine polymorphonuclear leukocytes was observed with all F. necrophorum isolates, but was not observed in any F. varium isolates. Susceptibility to antimicrobials was markedly different for F. varium as compared to F. necrophorum. In summary, no evidence of leukotoxin production was detected in any of the 23 F. varium isolates used in the current study. The data suggests that F. varium, the most common species isolated, may be a significant pathogen in deer with a different virulence mechanism than F. necrophorum. Tissue samples were cultured on prereduced Brucella agar plates b supplemented with 5% sheep blood, hemin (5 mg/l), and vitamin K (10 mg/l), and then incubated at 37°C for 48 hr in an anaerobic chamber. The 3-way antibiotic disk diffusion susceptibility test and nitrate test were conducted on Brucella agar plates with vancomycin, kanamycin, colistin, and nitrate disks.c Nitrate-negative isolates showing resistance to vancomycin and susceptibility to kanamycin and colistin were presumptively determined to be Fusobacterium sp.9 Following presumptive identification, the indole test was performed by placing 1 drop of indole reagent c onto an antibiotic disk. A pre-reduced McClung-Toabe egg yolk agar plate b was inoculated and incubated anaerobically at 37°C for 48-72 hr to determine lipase activity. Bile tolerance was determined by plating colonies onto pre-reduced Bacteroides fragilis isolation agar plates b containing 20% bile and incubating anaerobically at 37°C for 48-72 hr. Overnight cultures in prereduced anaerobically sterilized brain-heart infusion broth were observed for growth and sedimentation. All isolates were analyzed with commercial kits d,e according to the manufacturers' instructions. DNA extraction and 16S ribosomal DNA sequencingChromosomal DNA was extracted from all isolates. Briefly, cultures were grown anaerobically on pre-reduced blood agar plates at 37°C for 48-72 hr. The DNA was isolated using a commercial kit f according to the manufacturer's instructions. The extracts were stored at −20°C. Universal primers (p515FPL forward GCGGATCCTCTAGACT GCAGTGCCAGCAGCCGCGGTAA, and p13B reverse CGGGATCCCAGGCCCGGGAACGTATTCAC) were used to amplify a region of the 16S ribosomal RNA gene by polymerase chain reaction (P...

show abstract

“…In addition, the multiple bands that appeared in the current analysis supports the previous observation that the leukotoxin from F. necrophorum is highly unstable. 13,15 The difference in the banding pattern among the strains is most likely because of cleavage by proteolytic enzymes.…”

mentioning

confidence: 99%

Characterization ofFusobacterium necrophorumisolated from llama and alpaca

et al. 2013

View full text Add to dashboard Cite

Fusobacterium necrophorum, a Gram-negative, anaerobic bacterium, is an opportunistic animal and human pathogen that causes a variety of infections termed necrobacillosis. There are 2 subspecies of F. necrophorum (subsp. necrophorum and subsp. funduliforme) that differ morphologically and biochemically and in virulence. Leukotoxin, a secreted protein, is considered to be the major virulence factor. In camelids, F. necrophorum causes a variety of infections, generally involving the lips, tongue, pharynx, interdigital spaces, foot pad, larynx, mandible, or maxillary bones. The objective of the current study was to characterize the presumptive Fusobacterium isolates from a variety of necrotic infections in llama ( Lama glama) and alpaca ( Vicugna pacos) and determine whether the strains possess leukotoxin activities. A total of 7 isolates from alpaca and 2 isolates from llama were characterized. Based on growth characteristics in broth culture, and biochemical and polymerase chain reaction analyses, all 9 isolates belonged to subsp. necrophorum and possessed the putative hemagglutinin gene. Western blot analysis with antileukotoxin antibodies raised in rabbit showed the presence of leukotoxin protein in the culture supernatant of all isolates. Furthermore, flow cytometry of the culture supernatants demonstrated cytotoxicity to bovine and alpaca polymorphonuclear leukocytes (PMNs). The extent of cytotoxicity to either alpaca or bovine PMNs differed among camelid strains. The cytotoxicity of many of the camelid strains was higher ( P < 0.05) toward alpaca PMNs compared to bovine PMNs. Fusobacterium necrophorum isolates from llama and alpaca are similar to bovine isolates, and leukotoxin may be a major virulence factor.

show abstract

Factors affecting the leukotoxin activity of Fusobacterium necrophorum

Cited by 48 publications

References 25 publications

Liver abscesses in cattle: A review of incidence in Holsteins and of bacteriology and vaccine approaches to control in feedlot cattle12

Liver abscesses in cattle: A review of incidence in Holsteins and of bacteriology and vaccine approaches to control in feedlot cattle12

Characterization of Fusobacterium isolates from the respiratory tract of white-tailed deer (Odocoileus virginianus)

Characterization ofFusobacterium necrophorumisolated from llama and alpaca

Contact Info

Product

Resources

About