Factors determining selective predation of the common carp on quagga versus zebra mussels

Abstract

Selective predation may affect interspecific competition between coexisting prey species. Ponto‐Caspian zebra (Dreissena polymorpha) and quagga mussels (Dreissena rostriformis bugensis) have become common components of benthic communities in invaded ecosystems in Europe and North America, where they are exposed to predation by molluscivorous fish. In a pairwise food selection experiment, we examined whether an efficient predator of dreissenids, the common carp (Cyprinus carpio), selects between the two mussel species and, if so, which mussel traits (attachment, shell strength, nutritional value) are responsible for the discrimination. The fish were offered simultaneously the two mussel species in three separate treatments: (1) attached individuals; (2) unattached individuals; and (3) freshly removed soft tissue, as well as in three mussel size classes. The fish consistently selected quagga over zebra mussels, irrespective of mussel size and attachment status, including even soft tissues of both species. The success rate of fish attacks did not differ between the prey species. Smaller mussels were easier to crush and swallow, but more difficult to detach from the substratum. Thus, although interspecific differences in attachment and shell strength existed (small and medium zebra mussels had stronger shells and were more strongly attached than corresponding quagga mussels), these traits did not affect fish preferences. However, the differences in chemical composition of the body—the glycogen content (higher in large quagga vs. zebra mussels) and the caloric content (higher in small and medium quagga vs. zebra mussels)—were responsible for fish selection. The higher predatory pressure on the quagga versus zebra mussel suggests that differential predation is not a likely reason for the displacement of zebra by quagga mussels, currently occurring in many European and North American ecosystems. Thus, this phenomenon must be driven by other traits making the quagga mussel more competitive.

Competition between two congener invaders: Food conditions drive the success of the quagga over zebra mussel in a large shallow lake

“…The zebra mussel puts relatively more effort to energetically costly self‐defence than the quagga mussel, which is manifested in enhanced shell hardness and SOD activity. However, such a strategy might not be optimal in such waterbodies like the eastern basin of Lake Balaton, where food resources are limited, whereas predator pressure (Balogh, Serfőző, & Kobak, 2022) and contaminant stress (Balogh, Kobak, et al, 2022) are low. The progression of the primary energy source (carbohydrates) content seen in quagga mussels developing in food‐limited conditions suggests that although young individuals show a significant drawback against those living in suitable conditions, they make up for the disadvantages in adulthood.…”

“…The expression of the enzyme eliminating superoxide (superoxide dismutase, SOD) was studied by reverse transcription–polymerase chain reaction (PCR) in field survey samples, using 5–14 mussels (shell length of 15 mm) per species and basin (for exact numbers, see Figure 5). RNA isolation and quantification was carried out as described by Balogh, Serfőző, and Kobak (2022). PCR primers for SOD gene expression (both forward and reverse) were designed according to the sequences published in the National Center of Biotechnology Information (NCBI USA, forward sequence: AGCACTTACACACCCATTGCT; reverse sequence: ACAGGCTTAGCAGAGGGACA, Acc.…”

Size-selective predation by three estuarine zooplanktivorous fish species

“…Some species have been observed to switch between filter-feeding and particulate-feeding behaviours in response to changes in prey density (Jansen et al 2019). A similar but alternative theory may be the targeting of calories rather as biomass as the calories are a direct measure of energy (Cumminns and Wuycheck 1971;Balogh et al 2022). This is most likely if the different prey types have large differences in calorific content but not biomass.…”