Fast and automated detection of common carbapenemase genes using multiplex real-time PCR on the BD MAX™ system

Probst, Katja; Boutin, Sébastien; Bandilla, Michael; Heeg, Klaus; Dalpke, Alexander H.

doi:10.1016/j.mimet.2021.106224

Cited by 16 publications

(13 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Total RNA was extracted using TRIzol and the Direct-zol™ RNA Miniprep kit (Zymo Research) according to the manufacturer’s protocol and followed by an additional DNase treatment using the RQ1 RNase-Free DNase kit (Promega). The expressions of bla NDM and bla OXA-48 were determined by real-time quantitative PCR (RT-qPCR) (Luna Universal Probe One-Step RT–qPCR kit; New England Biolabs) relative to the 16S rRNA expression using previously published primers ( 37 ) for NDM-fw 5′- GCCACACCAGTGACAATATC -3′, NDM-rv 5′- GTGCTCAGTGTCGGCAT -3′, OXA-48-fw 5′- AGGGCGTAGTTGTGCTC -3′, OXA-48-rv 5′- GTGTTCATCCTTAACCACGC -3′‘and 16S-fw 5′- TCCTACGGGAGGCAGCAGT -3′, and 16S-rv 5′- GGACTACCAGGGTATCTAATCCTGTT -3′ in biological and technical duplicates.…”

Section: Methodsmentioning

confidence: 99%

New Delhi Metallo-Beta-Lactamase Facilitates the Emergence of Cefiderocol Resistance in Enterobacter cloacae

Nurjadi

Kocer

Chanthalangsy

et al. 2022

Antimicrob Agents Chemother

Self Cite

View full text Add to dashboard Cite

Cefiderocol is a promising novel siderophore cephalosporin for the treatment of multi-drug resistant Gram-negative bacilli and with stability against degradation by metallo-β-lactamases. Nonetheless, the emergence of cefiderocol in metallo-β-lactamase-producing Enterobacterales during therapy has been reported on more than one occasion. To understand the underlying mechanisms and factors facilitating the resistance development, we conducted an in vitro evolution experiment using clinical E. cloacae isolates via serial passaging under cefiderocol pressure. In this study, we show that the presence of the New-Delhi metallo-β-lactamase (NDM) facilitates the emergence of resistance via non-synonymous mutations of the CirA catecholate siderophore receptor. Inhibition of metallo-β-lactamase activity using dipicolinic acid prevented the emergence of cefiderocol-resistant mutants successfully. This finding implies that caution should be taken, when using cefiderocol for the treatment of infections caused by metallo-β-lactamase- producing bacteria.

show abstract

Section: Methodsmentioning

confidence: 99%

New Delhi Metallo-Beta-Lactamase Facilitates the Emergence of Cefiderocol Resistance in Enterobacter cloacae

Nurjadi

Kocer

Chanthalangsy

et al. 2022

Antimicrob Agents Chemother

Self Cite

View full text Add to dashboard Cite

show abstract

“…Antibiotic susceptibility testing was performed on the Vitek 2 (bioMérieux) and interpreted according to the EUCAST clinical breakpoints of the respective year of detection. The presence of carbapenemase was detected using an in-house PCR, as described elsewhere ( 37 , 38 ).…”

Section: Methodsmentioning

confidence: 99%

“…The species was identified using MALDI-TOF MS (Bruker Daltonics). Molecular detection/confirmation of carbapenemase genes were performed using an in-house PCR described elsewhere ( 37 ).…”

Section: Methodsmentioning

confidence: 99%

Genomic Investigation and Successful Containment of an Intermittent Common Source Outbreak of OXA-48-Producing Enterobacter cloacae Related to Hospital Shower Drains

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…The assay based on hydrolysis probes consists of two multiplex PCRs for the detection of bla NDM , bla KPC , bla VIM and bla IMP , and bla OXA-23 -like, bla OXA-40/24 -like, bla OXA-58 -like and bla OXA-48 -like, respectively. Amplification and detection were performed on the BD MAX™ system, using the protocol for the PCR-only mode, as described elsewhere [25].…”

Section: Multiplex Real-time Pcrmentioning

confidence: 99%

Molecular Detection of Carbapenemases in Enterobacterales: A Comparison of Real-Time Multiplex PCR and Whole-Genome Sequencing

et al. 2021

Self Cite

View full text Add to dashboard Cite

Carbapenem-resistant Enterobacterales are a growing problem in healthcare systems worldwide. While whole-genome sequencing (WGS) has become a powerful tool for analyzing transmission and possible outbreaks, it remains laborious, and the limitations in diagnostic workflows are not well studied. The aim of this study was to compare the performance of WGS and real-time multiplex PCR (RT-qPCR) for diagnosing carbapenem-resistant Enterobacterales. In this study, we analyzed 92 phenotypically carbapenem-resistant Enterobacterales, sent to the University Hospital Heidelberg in 2019, by the carbapenem inactivation method (CIM) and compared WGS and RT-qPCR as genotypic carbapenemase detection methods. In total, 80.4% of the collected isolates were identified as carbapenemase producers. For six isolates, discordant results were recorded for WGS, PCR and CIM, as the carbapenemase genes were initially not detected by WGS. A reanalysis using raw reads, rather than assembly, highlighted a coverage issue with failure to detect carbapenemases located in contigs with a coverage lower than 10×, which were then discarded. Our study shows that multiplex RT-qPCR and CIM can be a simple alternative to WGS for basic surveillance of carbapenemase-producing Enterobacterales. Using WGS in clinical workflow has some limitations, especially regarding coverage and sensitivity. We demonstrate that antimicrobial resistance gene detection should be performed on the raw reads or non-curated draft genome to increase sensitivity.

show abstract

Fast and automated detection of common carbapenemase genes using multiplex real-time PCR on the BD MAX™ system

Cited by 16 publications

References 27 publications

New Delhi Metallo-Beta-Lactamase Facilitates the Emergence of Cefiderocol Resistance in Enterobacter cloacae

New Delhi Metallo-Beta-Lactamase Facilitates the Emergence of Cefiderocol Resistance in Enterobacter cloacae

Genomic Investigation and Successful Containment of an Intermittent Common Source Outbreak of OXA-48-Producing Enterobacter cloacae Related to Hospital Shower Drains

Molecular Detection of Carbapenemases in Enterobacterales: A Comparison of Real-Time Multiplex PCR and Whole-Genome Sequencing

Contact Info

Product

Resources

About