FGF10 inhibits dominant follicle growth and estradiol secretion in vivo in cattle

Abstract

Fibroblast growth factors (FGFs) are involved in paracrine control of follicle development. It was previously demonstrated that FGF10 decreases estradiol (E 2 ) secretion in granulosa cell culture and that theca cell FGF10 mRNA expression is decreased in healthy follicles from abattoir ovaries. The main objectives of this study were to evaluate FGF10 and FGFR2b mRNA expression during follicular development in vivo, to evaluate the effect of FGF10 on follicle growth using Bos taurus taurus cows as a model, and to gain more insight into the mechanisms through which FGF10 inhibits steroidogenesis. Messenger RNA encoding both FGF10 and FGFR2b (main FGF10 receptor) was significantly more expressed in subordinate follicles (SFs) than in dominant follicles (DFs). The intrafollicular injection of FGF10 into the largest growing follicle at 7-8 mm in diameter interrupted the DF growth in a dose-dependent manner (11G0.4, 8.3G1 and 5.9G0.3 mm for 0, 0.1, and 1 mg/ml FGF10, respectively, at 72 h after treatment; P!0.05). In a third experiment, follicles were obtained 24 h after FGF10 (1 mg/ml) or PBS treatment through ovariectomy. In theca cells, FGF10 treatment did not affect mRNA encoding steroidogenic enzymes, LHCGR and IGFBPs, but significantly upregulated FGF10 mRNA expression. The expression of CYP19A1 mRNA in granulosa cells was downregulated by FGF10 treatment, which was accompanied by a 50-fold decrease in E 2 production, and decreased cyclin D2 mRNA. These results have shown that FGF10 and its receptor FGFR2b are more expressed in SFs and provide solid in vivo evidence that FGF10 acts as an important regulator of follicular growth in cattle.

Expression and Localization of Fibroblast Growth Factor 10 (FGF10) in Ovarian Follicle During Different Stages Development in Buffalo

“…In present study, our data regarding FGF10 expression pattern is not in line of agreement with earlier finding in human (Taniguchi et al, 2008), goat (Chaves et al, 2010) and cattle follicle (Buratini et al, 2007;Gasperin et al, 2012) where FGF10 mRNA expression was found to be decreased in mature or healthy follicle of human, goat and bovine ovary. In another study in human preantal follicle (Oron et al, 2012) FGF10 mRNA was observed regularly which is in opposition with our present data in relation to FGF10 expression pattern in bubaline follicle.…”

“…FGF10 transcript level was significantly decreased in theca cells of mature follicles in bovine (Buratini et al, 2007;Gasperin et al, 2012), goat (Chaves et al, 2010) and in theca and stromal cells of human ovary (Taniguchi et al, 2008). FGF10 mRNA was significantly more expressed in subordinate follicle than the dominat follicle in cattle ovary (Gasperin et al, 2012).…”

“…FGF10 transcript level was significantly decreased in theca cells of mature follicles in bovine (Buratini et al, 2007;Gasperin et al, 2012), goat (Chaves et al, 2010) and in theca and stromal cells of human ovary (Taniguchi et al, 2008). FGF10 mRNA was significantly more expressed in subordinate follicle than the dominat follicle in cattle ovary (Gasperin et al, 2012). FGF10 mRNA was expressed in oocytes and theca cells while acts on GC to inhibit steroidogenesis in bovine antral follicles (Buratini et al, 2007;Zhang et al, 2010;Caixeta et al, 2013).…”

Methods to study ovarian function in monovulatory species using the cow as a model

“…Five to nine days later, the progesterone devices are removed and follicular dynamics is followed by daily ultrasound examination until the growing follicles of the new follicular wave reach the target diameter to perform intrafollicular injection or ovariectomy. Follicles are monitored at least three times before intrafollicular treatment to confirm that only new growing follicles and no aged follicles are present in the ovaries (Gasperin et al, 2012). Despite less timeconsuming in comparison to estrus detection-based protocols, many cows are usually removed from the experiment because large follicles fail to regress after progesterone exposure.…”

Steroidogenic enzymes mRNA expression profile and steroids production in bovine theca cells cultured in vitro and stimulated with angiotensin II

“…The relative mRNA expression was calculated based on the amplification of the reference gene GAPDH according to PFAFFL et al (2001). The primers used for the amplification of CYP17A1 (sense: CCATCAGAGAAGTGCTCCGAAT and antisense: GCCAATGCTGGAGTCAATGA), CYP11A1 (sense: CTTGCACCTTTCTGGCTAGG and antisense: AAGGGGAAGAGGTAGGGTGA), HSD3B2 (sense: GCCCAACTCCTACAGGGAGAT and antisense: TTCAGAGCCCACCCATTAGCT) and STAR (sense: CCCAGCAGAAGGGTGTCATC and antisense: TGCGAGAGGACCTGGTTGAT) were based on previous studies (GASPERIN et al, 2012) and were synthetized by Invitrogen.…”