Filamentous bacteriophages are associated with chronic
            <i>Pseudomonas</i>
            lung infections and antibiotic resistance in cystic fibrosis

Burgener, Elizabeth B.; Sweere, Johanna M.; Bach, Michelle S.; Secor, Patrick R.; Haddock, Naomi L.; Jennings, Laura K.; Marvig, Rasmus Lykke; Johansen, Helle Krogh; Rossi, Elio; Cao, Xiou; Tian, Lu; Nedelec, Laurence; Molin, Søren; Bollyky, Paul L.; Milla, Carlos

doi:10.1126/scitranslmed.aau9748

Cited by 97 publications

(143 citation statements)

References 60 publications

Supporting

Mentioning

124

Contrasting

Unclassified

Order By: Relevance

“…The second method includes a combination of mechanical homogenization with bead beating and heat followed by use of a commercially available DNA extraction kit designed for isolation of genomic DNA. [20] We refer to this method as mechanical dissociation. After processing Pf phage were measured in all aliquots using qPCR ( Figure 2) with significantly more Pf phage detected in the sample processed by mechanical dissociation.…”

Section: Pf Phage Can Be Detected In Cf Sputummentioning

confidence: 99%

“…Pf phage and P. aeruginosa in sputum was quantified by quantitative PCR as we have previously described. [15,20] targeting Pfcon (PA0717), a gene that is conserved across diverse strains of Pf phage (Pf1, Pf4, Pf5), were used together with a PA0717 probe (AACGCTGGGTCGAAG). For P. aeruginosa quantification, primers targeting the 50S ribosomal protein gene rpIU (rpIU-F (CAAGGTCCGCATCATCAAGTT) and rpIU-R (GGCCCTGACGCTTCATGT)) were used together with a rpIU probe (CGCCGTCGTAAGC).…”

Section: Pf Phage and P Aeruginosa Pcrmentioning

confidence: 99%

“…We and others have recently reported that Pf phage influence the pathogenesis of P. aeruginosa infections in the lung and other environments by inducing liquid crystal biofilm and promoting chronic infection. [11,12,[15][16][17][20][21][22] For all of these reasons there is a pressing need for effective and reliable protocols for assessments of both phage and bacteria in CF sputum. [23,24] Respiratory secretions are primarily composed of polymeric mucins (MUC5AC and MUC5B) that form a gel like material with complex rheological properties that form the basis for its function as an innate defense barrier, including viscoelasticity, cohesiveness, adhesiveness and wetness.…”

Section: Introductionmentioning

confidence: 99%

“…To this end, our protocols have been optimized for collecting DNA from Pf bacteriophage and the bacterium which produces it, P. aeruginosa. [20] We have focused on a DNA phage here, though it would be straightforward to modify this protocol to examine RNA viruses. These protocols reflect our recent experience in quantification and sequencing of these microbes.…”

Section: Introductionmentioning

confidence: 99%

“…These protocols reflect our recent experience in quantification and sequencing of these microbes. [15][16][17]20] To our knowledge this is the first systematic approach to develop a standardized method that could be used by other investigators and thus allow for meaningful comparisons. Our hope is that sharing our optimized protocols will facilitate future studies on both bacteria and phage in CF airway infections.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Methods for Extraction and Detection of Bacteriophage DNA from the Sputum of Patients with Cystic Fibrosis

Burgener

Secor

Tracy

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

There is increasing interest in the pulmonary microbiome's bacterial and viral communities, particularly in the context of chronic airway infections in cystic fibrosis (CF). However, the isolation of microbial DNA from the sputum from patients with CF is technically challenging and the optimal protocols for the analysis of viral species, including bacteriophage, from clinical samples remains challenging. Here, we evaluate a set of methods developed for processing and analyzing sputum from patients with CF with a particular emphasis on detecting bacteriophage viron-derived nucleic acid. We evaluate the impact of bead-beating, deoxyribonuclease digestion, and heating steps in these protocols focusing on the quantitative assessment of Pseudomonas aeruginosa and Pf bacteriophage in sputum as a proof of concept. Based on these comparative data, we describe an optimized protocol for processing sputum from patients with CF and isolating DNA for PCR or sequencing-based studies. These studies will facilitate future assessments of bacteriophage and bacteria in sputum from patients with CF. Author SummaryPatients with cystic fibrosis (CF) have thickened secretions and develop chronic infections in their airways. While we culture bacterial pathogens from expectorated sputum this method favors detection of certain organisms. There is greater understanding that the microbiome with in the airway of patients with cystic fibrosis is varied and contains more than just the bacteria that we selectively culture. Processing sputum is difficult as it is very thick. There are many different ways to process sputum depending on what aspect of the sputum is to be studied. We have an interest in a specific bacteriophage, or a virus that infects bacteria. We sought to find the best method to take sputum from a CF patient and extract DNA so that we could detect both bacteria and bacteriophage DNA. We compared different methods that included different combinations of heat, mechanical homogenization, chemical lysis and DNA extraction by commercially available kits. We describe the method we found easiest to execute and produced the best yield for detection of both bacteria and bacteriophage. Our purpose of publishing this method in detail is to facilitate further study of viral and bacterial communities in the sputum of patients with CF.

show abstract

Section: Pf Phage Can Be Detected In Cf Sputummentioning

confidence: 99%

Section: Pf Phage and P Aeruginosa Pcrmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Methods for Extraction and Detection of Bacteriophage DNA from the Sputum of Patients with Cystic Fibrosis

Burgener

Secor

Tracy

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

Quantum Dots for Pathogenic Bacterial Monitoring and Combating

Liu

Zhang

2022

Advanced Optical Materials

View full text Add to dashboard Cite

including neonatal meningitis, [6] diarrhoea, [7] infected cutaneous wound [8] or bloodstream diseases, [9][10][11] etc. Antibiotic treatment strategies against these bacteria have been widely applied while antimicrobial resistance has been arousing gradually. [12][13][14][15][16][17] What is worse, the biofilmrelated infection has been a tough issue for bacterial infectious treatment since it is usually chronic and much harder to eradicate. [18][19][20] Therefore, effective antibacterial treatments for drug-resistant pathogenic bacteria are vital problems for clinical therapy. [21] Some anti-microbial trials were carried out like phages, bacteriocins, and antimicrobial peptides [22] along with various therapeutic methods. [23][24][25] Among them, nanomaterials are considered as compatible solutions [23,26] due to their facile synthesis methods and rich-sourced precursors, broad-spectrum sterilization, and low drug resistance. [27][28][29][30][31] Nanomaterials are generally easy to be modified or doped to enhance the affinity toward bacteria for the sake of combating or drug delivery. [32][33][34][35] The antibacterial mechanism [36,37] could be result from the sharp edges-based physical cutting, [38,39] photothermal effects, [40][41][42] and photo dynamic or chemical dynamic properties, that could produce reactive oxygen species (ROS).Pathogenic bacteria monitoring mainly conducted by culturing them in agar-based media, and subsequently testing them with biochemical probes. [43][44][45][46] Although this conventional method enables clinical diagnoses with relatively reliable outcomes, the long culturing time renders the "golden therapeutical window" for patients. So more rapid and accurate detecting technologies have been invented. One of the most evolutionary methods is the polymerase chain reaction, [47][48][49] which can identify the bacterial classification and provide gene expression level in a few hours with better accuracy. [47,50] Besides, the coupling of chromatography and mass spectra like matrix-assisted laser desorption ionization time-of-flight mass spectrometry [51][52][53][54][55] can play a more exact role in diagnosis. [56] Though these advanced instrumental-relied methods can lead to fast diagnostic, the expensive apparatus, environmentally unfriendly reagents, [57] professional sites and technical personnel requirements limited their utilization in real-time monitoring and point-of-care sensing. By contrast, easy and fast monitoring methods for the pathogen, such as electrochemical and fluorescence sensors, were brought out as powerful supplements. [58][59][60][61][62] Therein, Antibiotic resistance and pathogenic bacterial monitoring are two main challenges in clinical diagnostics and treatment of bacteria. To conquer those issues, many new materials and novel technologies are explored. Among them, quantum dots (QDs) are regarded as not only powerful bacteriostatic agents, but also bacterial monitoring probes due to their excellent photoluminescence properties, tunable multiwavelength lumine...

show abstract

Antibiotic resistance genes in bacteria: Occurrence, spread, and control

et al. 2021

View full text Add to dashboard Cite

The production and use of antibiotics are becoming increasingly common worldwide, and the problem of antibiotic resistance is increasing alarmingly. Drug-resistant infections threaten human life and health and impose a heavy burden on the global economy. The origin and molecular basis of bacterial resistance is the presence of antibiotic resistance genes (ARGs). Investigations on ARGs mostly focus on the environments in which antibiotics are frequently used, such as hospitals and farms. This literature review summarizes the current knowledge of the occurrence of antibiotic-resistant bacteria in nonclinical environments, such as air, aircraft wastewater, migratory bird feces, and sea areas in-depth, which have rarely been involved in previous studies.

show abstract

Filamentous bacteriophages are associated with chronic Pseudomonas lung infections and antibiotic resistance in cystic fibrosis

Cited by 97 publications

References 60 publications

Methods for Extraction and Detection of Bacteriophage DNA from the Sputum of Patients with Cystic Fibrosis

Methods for Extraction and Detection of Bacteriophage DNA from the Sputum of Patients with Cystic Fibrosis

Quantum Dots for Pathogenic Bacterial Monitoring and Combating

Antibiotic resistance genes in bacteria: Occurrence, spread, and control

Contact Info

Product

Resources

About