First cases of squirrelpox in red squirrels (<i>Sciurus vulgaris</i>) in Scotland

McInnes, Colin J.; Coulter, Lesley J.; Dagleish, M. P.; Fiegna, C.; Gilray, Janice; Willoughby, Kim; Cole, M; Milne, Elspeth; Meredith, Anna; Everest, DJ; MacMaster, AM

doi:10.1136/vetreccr.164.17.528rep

Cited by 8 publications

(15 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Here we report the first confirmed cases of squirrelpox affecting red squirrels from two separate locations in Ireland. The first red squirrel examined for disease was found dead within Tollymore Forest Park on 16 March 2011 and had external signs typical of those reported previously for squirrelpox (McInnes et al ., ). There were visible scabs on the face and feet and a purulent conjunctivitis.…”

Section: Discussionmentioning

confidence: 97%

“…Blood was collected post mortem , usually from the chest cavity. Sera were obtained by centrifugation of the blood samples at 2000 g for 5 min and examined for the presence of antibodies against SQPV as described elsewhere (Sainsbury et al ., ; McInnes et al ., ). Briefly, 96‐well plates were coated with SQPV‐ and control negative‐antigen before incubating with serum samples collected from the squirrels.…”

Section: Methodsmentioning

confidence: 97%

“…SQPV DNA was detected by PCR as previously described (McInnes et al ., ) using the primers SQ026F 5′ATGTCAGTCACGATAAGATT3′ and SQ026R 5′TCATGTCAGTCGGGTGATGA3′ that amplify a 258‐bp fragment of the SQPV genome corresponding to a gene that has been found, so far, only in SQPV, the Parapoxvirinae and Molluscum contagiosum virus. The primers are specific for SQPV and no cross‐reactivity has been found with other poxvirus DNA or squirrel genomic DNA.…”

Section: Methodsmentioning

confidence: 99%

“…This suggested that no matter what other influences were at work, SQPV was likely to have been a major factor in the decline of red squirrels in parts of the UK where the virus was found. Recently, epidemics of disease caused by SQPV have swept through populations of red squirrels, most notably in Formby on Merseyside, the English Lake District, north‐east England and the Borders region of Scotland, although the affected populations have not, yet at least, been totally eliminated by disease (McInnes et al ., ; Atkin et al ., ; Bruemmer et al ., ). Grey squirrels are now heavily controlled in these regions in an attempt to reduce the threat to the remaining red squirrels from squirrelpox disease.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

The emergence of squirrelpox in Ireland

McInnes

Coulter

Dagleish

et al. 2012

Animal Conservation

Self Cite

View full text Add to dashboard Cite

The native red squirrel Sciurus vulgaris population in Britain has been on the decline for many years. A poxvirus associated with the introduced American grey squirrel S. carolinensis has been recognized as having a major role in the reduction of red squirrel numbers by causing a deleterious disease, known as squirrelpox, from which they seldom recover. In Ireland, red squirrel numbers have also been reducing while the grey squirrel population, first introduced in 1911, has been expanding. Until now, no poxvirus-associated disease had been found in Irish red squirrels and therefore, the role of squirrelpox in the displacement of red squirrels by grey squirrels in Ireland has been questioned. Here we report, for the first time, confirmed squirrelpox disease in two populations of red squirrels in Northern Ireland. In addition, we present serological evidence of the extent of poxvirus infection in the grey squirrels from both the Republic of Ireland and Northern Ireland, including an apparent increase in the seroprevalence of antibodies against the virus in grey squirrels over the period of the study, and discuss the implications of our findings for the conservation tactics employed to protect red squirrels.

show abstract

Section: Discussionmentioning

confidence: 97%

Section: Methodsmentioning

confidence: 97%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

The emergence of squirrelpox in Ireland

McInnes

Coulter

Dagleish

et al. 2012

Animal Conservation

Self Cite

View full text Add to dashboard Cite

show abstract

“…Our assays offer several advantages over assays for SQPV (Atkin et al 2010;Fiegna et al 2016;McInnes et al 2009) and SADV (Everest et al 2009b), namely increased specificity (using a hydrolysis probe), sensitivity (using qPCR) and a reduction in the occurrence of false negatives (e.g. insufficient DNA purification and PCR inhibition) via the use of a specific squirrel endogenous IC.…”

Section: Discussionmentioning

confidence: 99%

Enhancement of wildlife disease surveillance using multiplex quantitative PCR: development of qPCR assays for major pathogens in UK squirrel populations

et al. 2016

View full text Add to dashboard Cite

Rapid development in polymerase chain reaction (PCR) technology has revolutionised the speed and accuracy of many diagnostic assays. However, comparatively few wildlife epidemiological studies use quantitative PCR (qPCR) for pathogen detection, even fewer employ an internal control, to ensure confidence in negative results, and PCR's ability to multiplex and therefore detect several targets in a single reaction is underutilised. Here, we describe the development of two multiplex qPCR assays for the red and grey squirrel that detect the pathogens squirrelpox virus (SQPV) and adenovirus in squirrels (SADV), both of which cause mortality in the red squirrel. Both assays use a section of the squirrel phosphoglycerate kinase gene as an endogenous internal control that identifies and compensates for both, inadequate sampling or PCR inhibition. Tests on infected squirrel tissue demonstrate that simple swab samples (particularly from distal antebrachial skin) are sufficient to detect and identify the relative quantity of SQPV DNA in both squirrel species, while rectal swabs and blood cell pellets can be used to reliably indicate SADV infection. These assays are sensitive and specific with an endogenous internal control providing confidence in negative results and allowing comparison across laboratories. Using such assays should prove advantageous in wildlife studies with limited resources while allowing the maximum data yield.

show abstract

European red squirrel population dynamics driven by squirrelpox at a gray squirrel invasion interface

Chantrey

Dale

Read

et al. 2014

Ecology and Evolution

View full text Add to dashboard Cite

Infectious disease introduced by non-native species is increasingly cited as a facilitator of native population declines, but direct evidence may be lacking due to inadequate population and disease prevalence data surrounding an outbreak. Previous indirect evidence and theoretical models support squirrelpox virus (SQPV) as being potentially involved in the decline of red squirrels (Sciurus vulgaris) following the introduction of the non-native gray squirrel (Sciurus carolinensis) to the United Kingdom. The red squirrel is a major UK conservation concern and understanding its continuing decline is important for any attempt to mitigate the decline. The red squirrel–gray squirrel system is also exemplary of the interplay between infectious disease (apparent competition) and direct competition in driving the replacement of a native by an invasive species. Time series data from Merseyside are presented on squirrel abundance and squirrelpox disease (SQPx) incidence, to determine the effect of the pathogen and the non-native species on the native red squirrel populations. Analysis indicates that SQPx in red squirrels has a significant negative impact on squirrel densities and their population growth rate (PGR). There is little evidence for a direct gray squirrel impact; only gray squirrel presence (but not density) proved to influence red squirrel density, but not red squirrel PGR. The dynamics of red SQPx cases are largely determined by previous red SQPx cases, although previous infection of local gray squirrels also feature, and thus, SQPV-infected gray squirrels are identified as potentially initiating outbreaks of SQPx in red squirrels. Retrospective serology indicates that approximately 8% of red squirrels exposed to SQPV may survive infection during an epidemic. This study further highlights the UK red squirrel – gray squirrel system as a classic example of a native species population decline strongly facilitated by infectious disease introduced by a non-native species. It is therefore paramount that disease prevention and control measures are integral in attempts to conserve red squirrels in the United Kingdom.

show abstract

First cases of squirrelpox in red squirrels (Sciurus vulgaris) in Scotland

Cited by 8 publications

References 15 publications

The emergence of squirrelpox in Ireland

The emergence of squirrelpox in Ireland

Enhancement of wildlife disease surveillance using multiplex quantitative PCR: development of qPCR assays for major pathogens in UK squirrel populations

European red squirrel population dynamics driven by squirrelpox at a gray squirrel invasion interface

Contact Info

Product

Resources

About