First Isolation and Characteristics of Bovine Parainfluenza Virus Type 3 from Yaks

Abstract

The yaks belong to the genus Bos within the family Bovidae that live in the Tibet Plateau and is an indispensable economic resource for the local herders. Respiratory tract infections are common diseases in yaks caused by various pathogens; however, there have been no reports of bovine parainfluenza virus type 3 (BPIV3) infection. This study was conducted to investigate the pathogens and analyze their characteristics from the four yak lung samples with severe respiratory tract infection symptoms in the yak farm. Results showed that out of four lung samples, three were identified as BPIV3-positive by RT-PCR. A BPIV3 strain (106.5TCID50/mL) was successfully isolated from the BPIV3-positive lung samples using Madin–Darby bovine kidney cells. The isolate caused systemic infection in the BALB/c mice and induced pathological changes in the lungs. Moreover, three complete BPIV3 genomes were amplified from the clinical samples. Phylogenetic trees based on the complete genomes, hemagglutinin-neuraminidase protein (HN), phosphoprotein (P), and large polymerase subunit protein (L) amino acid sequences showed that the complete BPIV3 genomes belonged to BPIV3 genotype C, and clustered into a large branch with the Chinese strains, although the three yak BPIV3 strains were clustered into a small branch. Compared to known BPIV3 genotype C strains in GenBank, the three genomes of yak BPIV3 showed four identical amino acid mutations in the HN, P and L proteins, suggesting a unique genetic evolution of BPIV3 in yaks. This study first isolated and characterized the BPIV3 from yaks, which contributed to the understanding of the infection and evolution of BPIV3 in yaks in the Tibet Plateau.

Prevalence, Molecular Characteristics and Virulence Identification of Bovine Parainfluenza Virus Type 3 in China

“…The results showed that all guinea pigs developed significant respiratory symptoms and pathological lung changes after being intranasally inoculated with the isolates. Our findings differed from previous investigations [ 18 , 33 , 34 , 35 , 36 ], which may be related to the animal species and the virulence of the strains. Among three infection groups, guinea pigs inoculated with Hubei-03 had the most obvious clinical symptoms, the most obvious pathological changes, and the highest viral load in the lungs, which indicated that the pathogenicity of the Hubei-03 strain had the highest virulence among all the isolated viruses.…”

“…Here, we reported a 13.16% (95% CI: 4.41–28.09) (5/38) BPIV-3 herd-level and 4.64% (95% CI: 2.56–7.66) (14/302) individual-level proportion in cattle, indicating that BPIV-3 commonly exists in cattle farms with BRDC outbreaks in China, which is consistent with a previous limited study [ 17 ]. The predominant genotype of BPIV-3 in China is C [ 5 , 14 , 18 ], which also aligned with our results.…”

“…The one-step growth curve was conducted as follows: MDBK cells that had reached confluence were inoculated with BPIV-3 isolates at 0.1 MOI (multiplicity of infection). Virus samples were collected at 3,6,9,12,18,24,30,36,42,48,60, and 72 h after inoculation. The obtained virus was frozen and thawed three times before the viral titer was evaluated using TCID 50 .…”

Isolation and Genomic Characterization of a Chinese Genotype C Bovine Parainfluenza Virus Type 3 from Cattle and Its Pathogenicity in C57BL/6 Mice

“…To confirm the SC strain isolated in MDBK cells, RNA from virus-infected supernatant was extracted using TRIzol reagent (Invitrogen, Waltham, MA, USA) and then tested using the specific RT-PCR method. Two pairs of primers, BPIV-3-F1 (GAATGACTCATGATAGAGGTAT) and BPIV-3-R1 (AGGACAACCAGTTGTATTACAT) and BPIV-3-F2 (GCTCTTCTCTTTTTGTCCCATTCTT) and BPIV-3-R2 (AACCCCTTCCTCA ATCCTGATATAC), were used here to confirm the presence of BPIV-3 SC with the corresponding PCR amplicons of 647 bp and 422 bp, respectively [21,25].…”

Protective efficacy of a recombinant adenovirus expressing novel dual F and HN proteins of bovine parainfluenza virus type 3

“…The HEK293 and MDBK cell lines are preserved in our laboratory. BPIV3 genotype C (SMU-SC20) strain (GenBank: OM621819.1) [29] and BPIV3 genotype A (B15) strain (GenBank: PP025529.1) were isolated from yaks and water buffaloes suffering from BRDC, respectively. This viruses titer were 1×10 6.5 TCID 50 /mL and 1×10 6.45 TCID 50 /mL, respectively [29].…”