First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia

Abstract

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Molecular features of new Peach Latent Mosaic Viroid variants suggest that recombination may have contributed to the evolution of this infectious RNA

“…PLMVd is known to infect peach (Prunus persica) in Europe, Asia, Africa, and both North and South America (Hadidi et al, 1997;Pelchat et al, 2000;Fekih Hassen et al, 2004). It has also been detected occasionally in apricot (Prunus armeniaca), plum (Prunus domestica), sweet cherry (Prunus avium), cultivated pear (Pyrus communis), wild pear (Pyrus amygdaliformis), mume (Prunus mume), and almond (Prunus amygdalus) (Faggioli et al, 1997;Hadidi et al, 1997;Kyriakopoulou et al, 2001;Fekih Hassen et al, 2004.…”

“…PLMVd is known to infect peach (Prunus persica) in Europe, Asia, Africa, and both North and South America (Hadidi et al, 1997;Pelchat et al, 2000;Fekih Hassen et al, 2004). It has also been detected occasionally in apricot (Prunus armeniaca), plum (Prunus domestica), sweet cherry (Prunus avium), cultivated pear (Pyrus communis), wild pear (Pyrus amygdaliformis), mume (Prunus mume), and almond (Prunus amygdalus) (Faggioli et al, 1997;Hadidi et al, 1997;Kyriakopoulou et al, 2001;Fekih Hassen et al, 2004. Molecular variants isolated from European and North American sources have 335 to 351 nt and showed high naturally occurring polymorphism (Hernandez and Flores, 1992;Shamloul et al, 1995;Ambros et al, 1998;Pelchat et al, 2000;Malfitano et al, 2003).…”

Mixed infections of pome and stone fruit viroids in cultivated and wild trees in Greece

“…Our findings reveal for the first time natural mixed infections of apple and wild apple with ASSVd, PBCVd and HSVd, of quince with ASSVd and PBCVd and of wild apple and sweet cherry with ASSVd and HSVd. Mixed viroid infections of ASSVd, PBCVd and Peach latent mosaic viroid (PLMVd) in pear and wild pear (Kyriakopoulou et al, 2001), of PLMVd and HSVd in peach (Prunus persica) (Hassan et al, 2004;Tessitori et al, 2002) and of PBCVd, PLMVd and HSVd in pear (Fekih-Hassen et al, 2004) have been reported previously. The presence of natural viroid infections in wild species away from human influence in Greece suggests that ASSVd, PBCVd and PLMVd originated in wild hosts and are probably native to Greece (Kyriakopoulou et al, 2001); our data for ASSVd, PBCVd and HSVd support this hypothesis (Kaponi 2009).…”

Distribution of Peach latent mosaic viroid in Commercial Orchards of Peach in the North of Tunisia

“…In Spain, while the native cultivars were not infected, the percentage of imported and infected varieties reached 85% (Badenes and Llacer, 1998). PLMVd has been detected in other species of fruit trees, such as apricot ( Prunus armeniaca ), plum ( Prunus domestica ), sweet cherry ( Prunus avium ), cultivated pear ( Pyrus communis ) and wild pear ( Pyrus amygdaliformis ) from European countries (Faggioli et al., 1997; Hadidi et al., 1997; Kyriakopoulou et al., 2001) and recently, pear and almond ( Prunus amygdalus ) from Tunisia (Fekih Hassen et al., 2004, 2005). The economic importance of PLMVd derives from the fruit alterations, reduced tree longevity and increased susceptibility to other biotic or abiotic stress (Flores et al., 2006).…”

“…Peach culture has an economic importance in Tunisia as it occupied more than 22 000 hectares producing approximately 108 000 tons in 2005. A preliminary survey revealed that the PLMVd was present in Tunisian orchards and it represents one of the most important threats for the peach production (Fekih Hassen et al., 2004). Several questions rose from this preliminary study: what is the incidence of PLMVd in different Tunisian regions?…”