First Report of Rice stripe necrosis virus Infecting Rice in Benin

Abstract

International audienc

Genetic Diversity of Rice stripe necrosis virus and New Insights into Evolution of the Genus Benyvirus

“…The isolates from Mali originated from lowland rice fields in the San region, and from pluvial rice plots at Bama in Burkina Faso. Four rice samples previously collected between 2014 and 2019 from Benin (Be2) [ 4 ], Mali (M1-1 and M2-1) [ 5 ] and Sierra Leone (SL254) [ 6 ] were also used in this study. Specifically, Malian isolates have been maintained under greenhouse conditions in separate tube cultures of rice var.…”

“…For instance, the rice stripe necrosis virus (RSNV) has recently emerged in America and is re-emerging in Africa. Hence, while RSNV was initially identified in the Ivory Coast in 1983 [ 2 ] and almost undetected since then, characteristic symptoms of crinkling yellow and deformation of rice leaves were recently observed in West-African countries, including Burkina Faso [ 3 ], Benin [ 4 ], Mali [ 5 ] and Sierra Leone [ 6 ]. The incidence of disease ranges locally from 37% to 80% in these African countries.…”

First report of Rice stripe necrosis virus infecting rice in Sierra Leone

“…Later, the virus was reported in South and Central America (Colombia, Ecuador, Panama and Brazil) causing up to 40% yield losses (Morales et al ., 1999). Recently, RSNV was identified for the first time in several African countries including Burkina Faso (Sérémé et al ., 2014), Benin (Oludare et al ., 2015) and Mali (Decroës et al ., 2017) suggesting a re‐emergence of the virus in Africa.…”

“…The presence of the virus was confirmed after total RNA extraction using 0.05 g of leaves and the RNeasy Plant Mini Kit (Qiagen) and RT‐PCR amplification (10 U/μl M‐MLV‐reverse transcriptase, Promega; 10 U/μl Dynazyme, Finnzyme) as described previously (Sérémé et al ., 2014, Oludare et al ., 2015) with primers RSNV1‐2901F 5'‐TGAATTTGGTGCTCTCTTG‐3' / RSNV1‐3827R 5'‐TGTGGCGTTTCCAGACCTAAA‐3' and RSNV2‐5' 5'‐TATCACTACTGACGAATTCCACCTAC‐3' / RSNV2‐1223R 5'‐AATCTGCGGCCTGTTTTGTA‐3'. Specific amplicons, 926 and 1241 nt in length, were generated corresponding to sequences in the helicase domain and the coat protein (CP) genes on RSNV RNA 1 and RNA 2, respectively.…”

Evaluating the incidence and severity of rice yellow mottle virus and maize streak virus on rice (Oryza sativa L.) and associated insects in the Federal Capital Territory, Abuja, Nigeria

“…The high and consistent rainfall recorded in 2019 rice growing season could have been responsible for the low vector population and absence of infection, as the vectors would have been washed away. The two viruses that were selected for detection have been reported in other West African countries as well as some parts of Nigeria (Sere et al, 2008;Banwo et al, 2004;Alegbejo, 2013;Oludare et al, 2015;Odedara et al, 2016;Onasanya et al, 2011). Odedara (2016) reported from surveys carried out in Ogun State in 2012 the presence of RYMV in 7.7% of leaf samples collected and tested from Ewekoro Local Government Area (LGA) and 13.3% from leaf samples collected and tested from Obafemi Owode LGA.…”