First report on the complete mitochondrial genome of the deep-water scalpellid barnacle <i>Arcoscalpellum epeeum</i> (Cirripedia, Thoracica, Scalpellidae)

Kim, Se‐Joo; Kang, Hyun Mi; Corbari, Laure; Chan, Benny K. K.

doi:10.1080/23802359.2018.1532844

Cited by 4 publications

(5 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our mitogenome data indicate that the pollicipedids diverged immediately before the balanomorphs, and were followed closely by the calanticids (Figure 2, Supplementary Figure 1) with robust support. These findings coincide with the Bayesian results of Linse et al (2013), as well as the relatively constant position occupied by the pollicipedids in all mitochondrial genome-based phylogenetic analyses (Song et al, 2017;Cai et al, 2018;Kim et al, 2018;Kim et al, 2019;Chen et al, 2019;Lee et al, 2019;Tian et al, 2020). The mitogenome arrangement of calanticids and pollicipedids more closely resembles the patterns of balanomorphs, except for Smilium sinense which shows remote inversion events of the gene blocks, C-Y-nad1-L1-rrnL-V-rrnS and I-M (Figure 3).…”

Section: Phylogeny and Evolutionary History Of Barnaclessupporting

confidence: 82%

“…our analysis. It had also not been confirmed in the mitochondrial genome analyses of Kim et al (2018); Kim et al, (2019) and Lee et al (2019), or the multiple gene analyses of Linse et al (2013); Rees et al (2014), Herrera et al, (2015, and Kim et al (2022). Furthermore, the mitogenome arrangement of verrucomorph species, which displayed unique gene blocks (Figure 3), was distinctly different from that of the balanomorphs and other barnacles.…”

Section: Phylogeny and Evolutionary History Of Barnaclesmentioning

confidence: 94%

See 1 more Smart Citation

Phylogeny and adaptative evolution to chemosynthetic habitat in barnacle (Cirripedia: Thoracica) revealed by mitogenomes

Gan

Jones²,

Liu³

et al. 2022

Front. Mar. Sci.

View full text Add to dashboard Cite

Thoracican barnacles represent a unique group that has evolved in parallel identical somatotype s (sessile, stalked and asymmetric) in both normal and chemosynthetic environments. Hydrothermal vents and methane seeps are typical extreme deep-sea chemosynthetic habitats for marine macrobenthos. Characterizing the evolutionary history and adaptive strategy of barnacles is fundamentally important for understanding their origin, speciation, and diversification. Herein, we performed a series of phylogenetic analyses focusing on the mitochondrial genomes of the main extant barnacle lineages. Phylogenetic inferences and topology tests contradict the view of the sister relationship between verrucomorphs and balanomorphs, instead revealing that pollicipedids, calanticids and balanomorphs share common ancestor. Selective pressure analyses indicate that the two barnacle lineages of chemosynthetic ecosystems exhibit similar patterns in their evolution of adaptive characters, but have diverse and specific positive substitution sites of mitogenomes. Divergence times suggest that chemosynthetic barnacles originated in the Cenozoic, coinciding with the origins of other metazoan animals in chemosynthetic habitats as well as the Paleogene mass extinction and oceanic anoxic events. It is reasonable to suppose that ecological niche vacancy, sitotaxis, gene specificity in adaptive stress responses, and the subdivision of the ecological niche contributed to the origin and diversification of barnacles in chemosynthetic ecosystems.

show abstract

Section: Phylogeny and Evolutionary History Of Barnaclessupporting

confidence: 82%

Section: Phylogeny and Evolutionary History Of Barnaclesmentioning

confidence: 94%

Phylogeny and adaptative evolution to chemosynthetic habitat in barnacle (Cirripedia: Thoracica) revealed by mitogenomes

Gan

Jones²,

Liu³

et al. 2022

Front. Mar. Sci.

View full text Add to dashboard Cite

show abstract

“…On 5 December 2016, V. fijiensis specimens were collected from North Fiji Basin (16 59 0 S and 173 55 0 E; 1988 m depth). Genomic DNA extraction, sequencing, gene annotation, and phylogenetic analyses followed the methods of Kim et al (2017Kim et al ( , 2018. An ambiguous mixed peak Y at nucleotide site 48 of tRNA Gln was changed to C (forward primer, FBar_F2: TAAGTAGCAACCCTCAAGGT; reverse primer, FBar_R2_N: AGTTCTATGGCTTCGTGGAA) by Sanger sequencing.…”

Section: Vulcanolepas Fijiensis;mentioning

confidence: 99%

“… 2015 ; Kim et al. 2018 ). The eolepadid V. fijiensis and the scalpellid A. epeeum formed a monophyletic clade with high support values of 90% BP and 1.00 BPP.…”

mentioning

confidence: 99%

Complete mitochondrial genome of the hydrothermal vent stalked barnacle Vulcanolepas fijiensis (Cirripedia, Scalpelliforms, Eolepadidae)

Lee

Kang

Chan

et al. 2019

Mitochondrial DNA Part B

Self Cite

View full text Add to dashboard Cite

The family Eolepadidae is the only stalked barnacle in hydrothermal vent regions. Here, we determined the mitogenome of the eolepadid Vulcanolepas fijiensis. The mitogenome was 17,374 bp long, with 76.6% AT content. Its protein-coding gene organization was identical to that of the deep-sea scalpellid Arcoscalpellum epeeum. On the mitogenomic tree, two scalpellomorphan families (Eolepadidae and Scalpellidae) were monophyletic while the other scalpellomorphan family Pollicipedidae did not form the monophyletic group with them. Further mitogenomic analysis of undetermined taxa in hydrothermal vents is required to deepen our understanding of their phylogenetic relationships.

show abstract

“…In November 2016, Alviniconcha boucheti samples were collected from the North Fiji Basin (19 03 0 S and 173 29 0 E; 2717 m depth) using the ROV 'ROPOS' (Canadian Scientific Submersible Facility). Genomic DNA extraction and mitochondrial genome amplification followed the methods of Kim et al (2018). Library construction and sequencing were performed by Macrogen Service (Macroge, Seoul, Korea) using the Illumina NovaSeq sequencing platform (Illumina, San Diego, CA).…”

Section: Alviniconcha Boucheti;mentioning

confidence: 99%

Complete mitochondrial genome of the hydrothermal vent provannid snail Alviniconcha boucheti (Gastropoda: Abyssochrysoidea) from the North Fiji Basin

Lee

Hou

et al. 2020

Mitochondrial DNA Part B

Self Cite

View full text Add to dashboard Cite

The family Provannidae is endemic to chemosynthetic environments in the deep-sea. Here, we report the complete mitogenome of a provannid vent snail Alviniconcha boucheti from the North Fiji Basin for the first time. The length of mitogenome was 15,981 bp, with 67.7% AT content. The mitogenome content and its protein-coding gene organization resembled those of other provannid snails. According to the phylogenetic tree, A. boucheti was most closely related to Ifremeria nautilei. Along with this result, further mitogenomic analysis of undetermined taxa within gastropods would improve our understanding in their taxonomic relationship and biogeography. ARTICLE HISTORY

show abstract

First report on the complete mitochondrial genome of the deep-water scalpellid barnacle Arcoscalpellum epeeum (Cirripedia, Thoracica, Scalpellidae)

Cited by 4 publications

References 9 publications

Phylogeny and adaptative evolution to chemosynthetic habitat in barnacle (Cirripedia: Thoracica) revealed by mitogenomes

Phylogeny and adaptative evolution to chemosynthetic habitat in barnacle (Cirripedia: Thoracica) revealed by mitogenomes

Complete mitochondrial genome of the hydrothermal vent stalked barnacle Vulcanolepas fijiensis (Cirripedia, Scalpelliforms, Eolepadidae)

Complete mitochondrial genome of the hydrothermal vent provannid snail Alviniconcha boucheti (Gastropoda: Abyssochrysoidea) from the North Fiji Basin

Contact Info

Product

Resources

About