Fisetin Alleviates Neointimal Hyperplasia via PPARγ/PON2 Antioxidative Pathway in SHR Rat Artery Injury Model

Abstract

The phenotypic transformation of proliferation and migration in vascular smooth muscle cells (VSMCs) from media to intima is the basic pathology of neointimal hyperplasia after angioplasty in hypertensive patients. Angiotensin II (AngII) stimulates oxidative stress in VSMC, inducing VSMC proliferation and migration, which is a critical factor in both developments of hypertension and angioplasty-induced arterial restenosis. Fisetin, a plant flavonoid polyphenol, has been reported to be antioxidative and potent senolytic. It is unknown whether fisetin would inhibit neointimal hyperplasia. Therefore, we investigated the role of fisetin in neointimal formation in vitro and in vivo. The rat thoracic aortic smooth muscle cells (A10 cells) stimulated by AngII were used as the in vitro neointimal hyperplasia model, where AngII significantly induced the proliferation and migration in A10 cells. We found that fisetin could dose-dependently inhibit the effect of AngII via inducing the expression of an antioxidant, paraoxonase-2 (PON2), whose overexpression could inhibit the proliferation and migration of A10 cells and downexpression by siRNA had the opposite effect. Furthermore, we found the mechanism of fisetin’s inducing PON2 expression involved PPARγ. Rosiglitazone, a PPARγ agonist, could increase PON2 expression in A10 cells, while the PPARγ inhibitor prevented the effect of fisetin on PON2. The in vivo neointimal hyperplasia model was established 2 weeks after the carotid artery balloon injury in SHR rats. Administration of fisetin (ip 3 mg/kg daily for 2 weeks) right after the injury significantly increased PON2 expression in the artery, inhibiting ROS production, and efficiently reduced carotid neointimal hyperplasia. These results indicate that fisetin increases the expression of antioxidant PON2 via activation of PPARγ, reducing oxidative stress, inhibiting VSMC proliferation and migration, and alleviates neointimal hyperplasia after intimal injury. PON2 may be a potential therapeutic target to reduce arterial remodeling after angioplasty in hypertensive patients.

Hemin mitigates contrast‐induced nephropathy by inhibiting ferroptosis via HO‐1/Nrf2/GPX4 pathway

“…The primer sequences for Nrf2 were 5′‐AGGTTGCCCACATTCCCAAA‐3′ (forward) and 5′‐ACGTAGCCGAAGAAACCTCA‐3′ (reverse). The primer sequences for GAPDH were 5′‐GAATACGGCTACAGCAACAGG‐3′ (forward) and 5′‐GGTCTGGGATGGAAATTGT‐G‐3′ (reverse) 37 …”

“…Cell vitality of HK-2 cells was determined by MTT (Beyotime) and lactate dehydrogenase (LDH) activity detection, as previously described. 37 HK-2 cells were seeded into 96-well culture plates at a density of 1 Â 10 5 cells/well and were allowed to grow to subconfluence (70%-80%), and then were serum starved for another 6 hours. Quiescent cells were treated with indicated reagents.…”

“…Plasmid transfection and siRNA interference were performed as previously described. 37 Nuclear factor erythroid 2-related factor 2 plasmid (Sangon) and GPX4 siRNAs (RIBOBIO) were synthesized for the transfection in HK-2 cells. When cells reached 80% confluence, plasmid…”

“…The primer sequences for GAPDH were 5 0 -GAATACGGCTACAGCAACAGG-3 0 (forward) and 5 0 -GGTCTGGGATGGAAATTGT-G-3 0 (reverse). 37…”

Vascular Smooth Muscle Cells Phenotypic Switching in Cardiovascular Diseases

“…Percutaneous transluminal coronary angioplasty with balloon inflation applied to patients with coronary artery stenosis began to come into vogue in the late 1970s [ 54 ]. With the gradual maturity of percutaneous transluminal angioplasty (PTA), its clinical utilization rate has increased, but restenosis is accompanied by problems that limit its long-term efficacy [ 4 , 55 ]. Bare-metal stents then began to be phased into clinical practice.…”