Five new species of dictyostelid social amoebae (Amoebozoa) from Thailand

Abstract

BackgroundDictyostelid cellular slime molds (dictyostelids) are common inhabitants of the soil and leaf litter layer of fields and forests, along with animal dung, where they feed mostly on bacteria. However, reports on the species diversity of dictyostelids in South Asia, particularly Thailand, are limited. The research reported in this paper was carried out to increase our knowledge of the species diversity of this group of organisms in northern Thailand.ResultsForty soil samples were collected at four localities in northern Thailand to assess the species richness of dictyostelids. These samples yielded five dictyostelid isolates that were not morphologically consistent with any described species. Based on molecular signatures, all five of these isolates were assigned to the family Cavenderiaceae, genus Cavenderia. All five share a number of morphological similarities with other known species from this family. The new taxa differ from previously described species primarily in the size and complexity of their fruiting bodies (sorocarps). This paper describes these new species (Cavenderia aureostabilis, C. bhumiboliana, C. protodigitata, C. pseudoaureostipes, and C. subdiscoidea) based on a combination of morphological characteristics and their phylogenetic positions.ConclusionsAt least 15 taxa of dictyostelids were obtained from the four localities in northern Thailand, which indicates the high level of species diversity in this region. Five species were found to be new to science. These belong to the family Cavenderiaceae, genus Cavenderia, and were described based on both morphology and phylogeny.

Four New Species of Dictyostelids from Soil Systems in Northern Thailand

“…This fading of the yellow pigment is a common feature among the smaller members of the Thailand species in group 1 ( sensu Sheikh et al [ 3 ]) that have been studied, as a relict feature tending to disappear. This isolate is also larger than C. ungulata and C. aureostabil is [ 5 ], having similarly elongated, thin fruiting bodies also common in both species, and its sorocarps are more regular, sigmoid, and broken, and the bases are more variable. Spores are relatively large, and do not germinate immediately.…”

“…In addition to several common species of dictyostelids, nine isolates that could not be assigned to any described species were also recovered from the sampling. All of these isolates were subjected to a detailed morphological study of subcultures in addition to DNA sequence analyses, and five were described as new to science in a previous publication [ 5 ]. Five additional isolates, all obtained from samples collected from the tropical cloud forest (elevation 2500 m) in Doi Inthanon National Park, were also considered be morphologically distinct, albeit by only minor differences, and required additional investigation.…”

Additional new species suggest high dictyostelid diversity on Madagascar

“…It contains both functionally conserved regions with a slower rate of molecular evolution, as well as spacer regions that have highly variable sequences that are used to resolve relatively recent molecular divergence. This region has been used extensively for molecular delimitation of novel dictyostelid species (e.g., Cavender et al 2016;Liu et al 2019;Vadell et al 2018). For sequence amplification, the primers 18S-FA (5′→3′: AACCTGGTTGATCCTGCCAG) and 18S-RB (5′→3′: TGATCCTTCTGCAGGTTCAC) were used, following Medlin et al (1988), and these plus the primers D542F (5′→3′: ACAATTGGAGGGCAAGTCTG) and D134R (5′→3′: TCGAGGTCTCGTCCGTTATC) were used for internal sequencing and improved read quality, as described in Schaap et al (2006).…”

“…Sequences of closely related taxa were identified using a BLASTn search on NCBI GenBank. These results were crossreferenced with earlier phylogenies to ensure a broad and complete sampling of closely related taxa (Romeralo et al 2011(Romeralo et al , 2012Perrigo 2013;Cavender et al 2016;Vadell et al 2018). Additionally, three sequences from each sister genus, according to Sheikh et al (2018), were selected to serve as an outgroup for the Heterostelium and Raperostelium phylogenies, and three earlybranching taxa were selected to root the Cavenderia phylogeny, based on Perrigo (2013).…”

The Philippine slime molds after Dogma’s 1975 list–How far have we been?

“…Thailand, for example, reported 17 species from studies carried out in Chiang Mai, Nakhon Si Thammarat and Songkhla provinces (Cavender 1976, Seephueak & Petcharat 2014. Vadell et al (2018) has recently described five new species from soil samples collected in four localities in Northern Thailand.…”