Five nucleotides found in RCTG motifs are essential for post-fertilization methylation imprinting of the H19 ICR in YAC transgenic mice

Abstract

Genomic imprinting at the mouse Igf2/H19 locus is controlled by the H19 ICR, within which paternal allele-specific DNA methylation originating in sperm is maintained throughout development in offspring. We previously found that a 2.9 kb transgenic H19 ICR fragment in mice can be methylated de novo after fertilization only when paternally inherited, despite its unmethylated state in sperm. When the 118 bp sequence responsible for this methylation in transgenic mice was deleted from the endogenous H19 ICR, the methylation level of its paternal allele was significantly reduced after fertilization, suggesting the activity involving this 118 bp sequence is required for methylation maintenance at the endogenous locus. Here, we determined protein binding to the 118 bp sequence using an in vitro binding assay and inferred the binding motif to be RCTG by using a series of mutant competitors. Furthermore, we generated H19 ICR transgenic mice with a 5-bp substitution mutation that disrupts the RCTG motifs within the 118 bp sequence, and observed loss of methylation from the paternally inherited transgene. These results indicate that imprinted methylation of the H19 ICR established de novo during the post-fertilization period involves binding of specific factors to distinct sequence motifs within the 118 bp sequence.

Imprinted DNA methylation of the H19 ICR is established and maintained in vivo in the absence of Kaiso

“…A five-nucleotide mutation in the RCTG motifs (I–V, Fig. 1 B) within the 118-bp sequence disrupts in vitro binding to the protein in nuclear extracts, as well as post-fertilization imprinted methylation in transgenic mice (Δ5- H19 ICR) [ 22 ]. We found one KBS, designated 5ʹ-KBS, which overlaps with the RCTG motif IV, and another, designated 3'-KBS, in the downstream region.…”

“…To generate Kaiso knockout mice, two CRISPR RNAs (crRNAs) targeting the Kaiso gene sequence (5ʹ- ACCTGACTATTCGAAATGTG [AGG (PAM)] -3ʹ and 5ʹ -TGCAACTAGTCTACTTTCAG [AGG (PAM)] -3ʹ), trans-activating crRNA (tracrRNA) and Cas9 protein were introduced into fertilized eggs from wild-type C57BL/6 J mice. To generate ΔK- H19 ICR YAC-TgM, crRNA targeting the Δ36- H19 ICR YAC transgene sequence (5ʹ -CAGAACACACTTACATGGCA [TGG (PAM)] -3ʹ), tracrRNA, donor single-stranded oligodeoxynucleotides (5ʹ- GACCAAGGAAGCTTTCCTGCTCACTGTCCATTCAATGCAGTCAAAAGTGCTGTGACTATACAGGAGGAACATAGCA t TGCTGTGACCATACAGGAGGAACATAGCA t AGGCTAAAGGGCCATGGTGCCATGTAAGTGTGTTCTGTGCAGCAACTGATGACCAGACAGTACTGAGTCTGCCTGGAGCCTGAGTTAAAACCG -3ʹ, mutated nucleotides are bold, lower case letters) and Cas9 protein were introduced into fertilized eggs from Δ36- H19 ICR YAC-TgM [ 22 ]. Tail DNA from founder progeny was screened by PCR amplification and sequencing.…”

“…Gray boxes indicate 5ʹ- and 3ʹ-KBSs. Mutated nucleotides in Δ5- H19 ICR and the region deleted from Δ36- H19 ICR mutants are indicated below the sequence [ 22 ]. C Nucleotide sequences of the KBSs in the human IC1 B4 repeat and in the mouse H19 ICR 118-bp region.…”

“…Proteins that bind to the 118-bp sequence have been detected in nuclear extracts from P19 and ES cells [ 22 ]. In vitro binding experiments using mutant sequences showed that one of these proteins binds to five ‘RCTG’ motifs present in the 118-bp sequence.…”

“…This mutant transgene remained unmethylated even when paternally transmitted. Moreover, deleting the 36-bp sequence from the mouse H19 ICR transgene caused partial disruption of imprinted methylation; the 36-bp sequence is located at the 3ʹ end of the 118-bp sequence and lacks RCTG motifs [ 22 ]. Post-fertilization imprinted methylation in the mouse H19 ICR is therefore likely to be induced by regulatory factors that bind to one or more motifs within the 118-bp sequence.…”