Flock house virus replicates and expresses green fluorescent protein in mosquitoes

Assembly of many RNA viruses entails the encapsidation of multiple genome segments into a single virion, and underlying mechanisms for this process are still poorly understood. In the case of the nodavirus Flock House virus (FHV), a bipartite positive-strand RNA genome consisting of RNA1 and RNA2 is copackaged into progeny virions. In this study, we investigated whether the specific packaging of FHV RNA is dependent on an arginine-rich motif (ARM) located in the N terminus of the coat protein. Our results demonstrate that the replacement of all arginine residues within this motif with alanines rendered the resultant coat protein unable to package RNA1, suggesting that the ARM represents an important determinant for the encapsidation of this genome segment. In contrast, replacement of all arginines with lysines had no effect on RNA1 packaging. Interestingly, confocal microscopic analysis demonstrated that the RNA1 packaging-deficient mutant did not localize to mitochondrial sites of FHV RNA replication as efficiently as wild-type coat protein. In addition, gain-of-function analyses showed that the ARM by itself was sufficient to target green fluorescent protein to RNA replication sites. These data suggest that the packaging of RNA1 is dependent on trafficking of coat protein to mitochondria, the presumed site of FHV assembly, and that this trafficking requires a high density of positive charge in the N terminus. Our results are compatible with a model in which recognition of RNA1 and RNA2 for encapsidation occurs sequentially and in distinct cellular microenvironments.

Section: Methodsmentioning

confidence: 99%

Dual Roles for an Arginine-Rich Motif in Specific Genome Recognition and Localization of Viral Coat Protein to RNA Replication Sites in Flock House Virus-Infected Cells

Venter

Marshall

Schneemann

2009

“…cDNA clones of the FHV defective interfering RNA 634 (DI-634) and its derivative harboring the open reading frame (ORF) of enhanced green fluorescent protein (DI-eGFP) (15) were amplified in a PCR using the forward primer 5ЈGGGGTACGTAAACAATTCCA AGTTCCAAAATGG3Ј (the SnaBI site is underlined) and the reverse primer 5ЈCCGTACGTACCTTAGTCTGTTGACTT3Ј (the SnaBI site is underlined). The resulting products were digested with SnaBI and independently subcloned into the StuI-digested pCass4Rz vector.…”

Section: Methodsmentioning

confidence: 99%

Replication-Coupled Packaging Mechanism in Positive-Strand RNA Viruses: Synchronized Coexpression of Functional Multigenome RNA Components of an Animal and a Plant Virus in Nicotiana benthamiana Cells by Agroinfiltration

Panneerselvam¹,

Rofail²,

DeMason

et al. 2008

Flock house virus (FHV), a bipartite RNA virus of insects and a member of the Nodaviridae family, shares viral replication features with the tripartite brome mosaic virus (BMV), an RNA virus that infects plants and is a member of the Bromoviridae family. In BMV and FHV, genome packaging is coupled to replication, a widely conserved mechanism among positive-strand RNA viruses of diverse origin. To unravel the events that modulate the mechanism of replication-coupled packaging, in this study, we have extended the transfer DNA (T-DNA)-based agroinfiltration system to express functional genome components of FHV in plant cells (Nicotiana benthamiana). Replication, intracellular membrane localization, and packaging characteristics in agroinfiltrated plant cells revealed that T-DNA plasmids of FHV were biologically active and faithfully mimicked complete replication and packaging behavior similar to that observed for insect cells. Complementation with homologous replicase (with respect to CP) failed to enhance packaging specificity. Taken together, we propose that the transcription of CP mRNA from homologous replication and its translation must be synchronized to confer packaging specificity.Flock house virus (FHV), a member of the family Nodaviridae, and brome mosaic virus (BMV), the type member of the Bromovirus genus, are multicomponent positive-strand RNA viruses of animals and plants, respectively (44, 52). FHV was first isolated from the New Zealand grass grub Costelytra zealandica (52). The 4.5-kb single-strand positive-sense RNA genome of FHV is divided between two capped and nonpolyadenylated RNAs copackaged into a single nonenveloped icosahedral virion with a T ϭ 3 symmetry (50). Genomic RNA 1 (F1) is a 3,107-nucleotide (nt) sequence that encodes a 112-kDa RNA-dependent RNA polymerase (RdRp or protein A) that is necessary and sufficient for FHV RNA replication (8,27,42). In addition, F1 also encodes a 387-nt subgenomic RNA 3 (sgF3) sequence that corresponds to that of the 3Ј terminus of F1 (16,22). sgF3 encodes two proteins, b1 and b2. Protein b1 has no recognized function, and b2 is the designated suppressor of RNA silencing activity in Drosophila melanogaster S2 cells (33). Genomic RNA 2 (F2) is a 1,400-nt sequence that encodes the 43-kDa viral capsid protein (CP) precursor ␣ required for the assembly of FHV provirions (49). Each provirion consists of 180 subunits of protein ␣ arranged with a T ϭ 3 quasi-equivalent symmetry and the two genomic RNAs.Provirions are not infectious unless they undergo an autocatalytic maturation process, which results in the cleavage of protein ␣ into protein ␤ (38 kDa) and protein ␥ (5 kDa) (23, 51). sgF3 has been shown to trans activate F2 replication (20). The replication of FHV occurs on the outer mitochondrial membranes (36). An unusual and remarkable feature associated with FHV is its ability to cross the kingdom barrier and to infect a wide variety of cells, including cells of insects (23), mammals (8), yeasts (41), and several species of monocotyledonous and dicotyledon...

“…FHV is a potent pathogen of both Drosophila melanogaster and Anopheles gambiae adults, causing morbidity and mortality of from 50 to 100% in a dose-dependent manner (10,19,62). FHV induces morphological defects during infection and is disseminated throughout the insect to diverse tissues, including the fat body, the midgut, muscle, and the head (9,19). These observations raise the interesting possibility that apoptosis facilitates FHV cell-to-cell spread, perhaps by the transport of FHV through apoptotic vesicles in a manner analogous to that of the invertebrate ascoviruses (4).…”

Section: Vol 82 2008 Nodavirus-induced Apoptosis By Diap1 Depletionmentioning

confidence: 99%

Flock House Virus Induces Apoptosis by Depletion of Drosophila Inhibitor-of-Apoptosis Protein DIAP1

Settles

Friesen

2008

The molecular mechanisms by which RNA viruses induce apoptosis and apoptosis-associated pathology are not fully understood. Here we show that flock house virus (FHV), one of the simplest RNA viruses (family, Nodaviridae), induces robust apoptosis of permissive Drosophila Line-1 (DL-1) cells. To define the pathway by which FHV triggers apoptosis in this model invertebrate system, we investigated the potential role of Drosophila apoptotic effectors during infection. Suggesting the involvement of host caspases, the pancaspase inhibitor benzyloxycarbonyl-Val-Ala-Asp-fluromethylketone (z-VAD-fmk) prevented FHV-induced cytopathology and prolonged cell survival. RNA interference-mediated ablation of the principal Drosophila effector caspase DrICE or its upstream initiator caspase DRONC prevented FHV-induced apoptosis and demonstrated direct participation of this intrinsic caspase pathway. Prior to the FHV-induced activation of DrICE, the intracellular level of inhibitor-of-apoptosis (IAP) protein DIAP1, the principal caspase regulator in Drosophila melanogaster, was dramatically reduced. DIAP1 was depleted despite z-VAD-fmk-mediated caspase inhibition during infection, suggesting that the loss of DIAP1 was caused by an upstream FHV-induced signal. The RNA interferencemediated knockdown of DIAP1 caused rapid and uniform apoptosis of DL-1 cells and thus indicated that DIAP1 depletion is sufficient to trigger apoptosis. Confirming this conclusion, the elevation of intracellular DIAP1 levels in stable diap1-transfected cells blocked caspase activation and prevented FHV-induced apoptosis. Collectively, our findings suggest that DIAP1 is a critical sensor of virus infection, which upon virus-signaled depletion relieves caspase inhibition, which subsequently executes apoptotic death. Thus, our study supports the hypothesis that altering the level or the activity of cellular IAP proteins is a general mechanism by which RNA viruses trigger apoptosis.