Flunarizine inhibits osteoclastogenesis by regulating calcium signaling and promotes osteogenesis

Abstract

Many bone diseases such as osteoporosis and periodontitis are caused by hyperactivation of osteoclasts. Calcium (Ca 2+ ) signals are crucial for osteoclast differentiation and function. Thus, the blockade of Ca 2+ signaling may be a strategy for regulating osteoclast activity and has clinical implications. Flunarizine (FN) is a Ca 2+ channel antagonist that has been used for reducing migraines. However, the role of FN in osteoclast differentiation and function remains unknown. Here, we investigated whether FN regulates osteoclastogenesis and elucidated the molecular mechanism. FN inhibited osteoclast differentiation along with decreased expression of nuclear factor of activated T cells, cytoplasmic 1 (NFATc1), and attenuated osteoclast maturation and bone resorption. FN inhibition of osteoclast differentiation was restored by ectopic expression of constitutively active NFATc1. FN reduced calcium oscillations and its inhibition of osteoclast differentiation and resorption function was reversed by ionomycin, an ionophore that binds Ca 2+ . FN also inhibited Ca 2+ /calmodulin-dependent protein kinase IV (CaMKIV) and calcineurin leading to a decrease in the cAMP-responsive element-binding protein-dependent cFos and peroxisome proliferator-activated receptor-γ coactivator 1β expression, and NFATc1 nuclear translocation. These results indicate that FN inhibits osteoclastogenesis via regulating CaMKIV and calcineurin as a Ca 2+ channel blocker. In addition, FN-induced apoptosis in osteoclasts and promoted osteogenesis. Furthermore, FN protected lipopolysaccharide-and ovariectomy-induced bone destruction in mouse models, suggesting that it has therapeutic potential for treating inflammatory bone diseases and postmenopausal osteoporosis.

Comprehensive analysis of lncRNA-miRNA-mRNA networks during osteogenic differentiation of bone marrow mesenchymal stem cells

“…6 B). Among them, the pathway category “PI3K-Akt signaling pathway”, “Signaling pathways regulating pluripotency of stem cells”, “cGMP-PKG signaling pathway”, “Axon guidance”, and “Calcium signaling pathway” have previously been reported during osteogenic process [ 27 – 31 ]. The original data can be seen in Supplementary material 2 .…”

Exploring quality evaluation markers of Fructus Psoraleae based on chemometric analysis integrated with network pharmacology

“…The activation of the Wnt/β‐catenin signalling pathway can facilitate the production of bone marrow mesenchymal stem cells, mitigate ovariectomy‐induced bone loss, 51 and predominantly regulate osteoblast differentiation 52 . Calcium signals are crucial, and the blockade of calcium signalling has been proposed as a strategy for treating inflammatory bone diseases and postmenopausal osteoporosis 53 . It has been confirmed that many drugs can alleviate osteoporosis by promoting osteogenic differentiation and matrix mineralisation via the ERK signalling pathway 54 .…”

“…52 Calcium signals are crucial, and the blockade of calcium signalling has been proposed as a strategy for treating inflammatory bone diseases and postmenopausal osteoporosis. 53 It has been confirmed that many drugs can alleviate osteoporosis by promoting osteogenic differentiation and matrix mineralisation via the ERK signalling pathway. 54 So, it can be concluded that chemotaxonomic markers may alleviate osteoporosis via glycolysis, Wnt/β-catenin signalling, calcium signalling, ERK signalling, and so on.…”

Cholesterol sulfate inhibits osteoclast differentiation and survival by regulating the AMPK–Sirt1–NF‐κB pathway

“…The level of individual mRNA was normalized to that of actin mRNA, which was used as an internal control gene. Most primers have been described previously (Hong et al, 2017; Jo et al, 2021; Kim, Lee, et al, 2021; Lee, Lee, et al, 2019; Lee, Son, et al, 2019; Son et al, 2020). The unique primer used in this study was that of Rora mRNA (5′‐GTGGAGACAAATCGTCAGGAAT‐3′ and 5′‐TGGTCCGATCAATCAAACAGTTC‐3′).…”