Follicle-stimulating hormone potentiates the steroidogenic activity of chorionic gonadotropin and the anti-apoptotic activity of luteinizing hormone in human granulosa-lutein cells in vitro

Casarini, Livio; Riccetti, Laura; Pascali, Francesco De; Nicoli, Alessia; Tagliavini, Simonetta; Trenti, Tommaso; Sala, Giovanni Battista La; Simoni, Manuela

doi:10.1016/j.mce.2015.12.008

Cited by 69 publications

(80 citation statements)

References 95 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…However, hormone-specific effects are not maintained in the downstream Stard1 gene expression levels and steroid production in vitro, which occurs within the physiological range in mice [39, 40]. Each endpoint was evaluated at the proper time required to optimally measure its activation by practical methods, based on previous studies demonstrating their inter-dependency [18, 19, 29, 30]. …”

Section: Discussionmentioning

confidence: 99%

“…pErk1/2 and pCreb levels induced by LH or hCG treatment were analyzed by Western blotting, as previously described [18, 19, 29, 30]. Briefly, Leydig cells were seeded in 96-well plates (1 x 10 5 cells/well) and treated 15 min by increasing doses of LH or hCG (1 pM-100 nM range).…”

Section: Methodsmentioning

confidence: 99%

“…The hCG and LH 80% effective doses (EC 80s ) were calculated from the aforementioned cAMP dose–response curves, and were taken as the lowest, maximally activating gonadotropin concentrations (100 pM hCG and 1 nM LH), as previously described [19, 29]. EC 80s were used as fixed doses for the gene expression analysis.…”

Section: Methodsmentioning

confidence: 99%

“…Quantitative real-time PCR was performed in triplicates using specific mouse Stard1 gene primer sequences ( fwd : 5′- ACAGACTCTATGAAGAACTT -3′; rev : 5′- GACCTTGATCTCCTTGAC -3′) and settings: 95.0 °C for 30 s; 95.0 °C for 3 s - 45 cycles; 57.0 °C for 30 s. Normalized gene over the mouse hypoxanthine phosphoribosyltransferase ( Hprt ) gene expression ( fwd : 5′- TTGCTCGAGATGTCATGAAGGA -3′; rev : 5′- AGCAGGTCAGCAAAGAACTTATAG -3′) was evaluated using the 2 -ΔΔCt method [33]. Primer sequences were designed and validated as previously described [18, 19, 29]. …”

Section: Methodsmentioning

confidence: 99%

“…the methods for unit assignment to gonadotropins used for pharmacological treatment in humans. Human LH receptor mediates both quantitatively and qualitatively LH- and hCG-dependent signals in human primary granulosa cells [18, 19], revealing that LHCGR discriminates hormone-specific events. Therefore, we challenge the concept that gonadotropins’ activity can be properly characterized by the assessment of testosterone-dependent endpoints.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Human LH and hCG stimulate differently the early signalling pathways but result in equal testosterone synthesis in mouse Leydig cells in vitro

Riccetti

Pascali

Gilioli

et al. 2017

Reprod Biol Endocrinol

Self Cite

View full text Add to dashboard Cite

BackgroundHuman luteinizing hormone (LH) and chorionic gonadotropin (hCG) are glycoprotein hormones regulating development and reproductive functions by acting on the same receptor (LHCGR). We compared the LH and hCG activity in gonadal cells from male mouse in vitro, i.e. primary Leydig cells, which is a common tool used for gonadotropin bioassay. Murine Leydig cells are naturally expressing the murine LH receptor (mLhr), which binds human LH/hCG.MethodsCultured Leydig cells were treated by increasing doses of recombinant LH and hCG, and cell signaling, gene expression and steroid synthesis were evaluated.ResultsWe found that hCG is about 10-fold more potent than LH in cAMP recruitment, and slightly but significantly more potent on cAMP-dependent Erk1/2 phosphorylation. However, no significant differences occur between LH and hCG treatments, measured as activation of downstream signals, such as Creb phosphorylation, Stard1 gene expression and testosterone synthesis.ConclusionsThese data demonstrate that the responses to human LH/hCG are only quantitatively and not qualitatively different in murine cells, at least in terms of cAMP and Erk1/2 activation, and equal in activating downstream steroidogenic events. This is at odds with what we previously described in human primary granulosa cells, where LHCGR mediates a different pattern of signaling cascades, depending on the natural ligand. This finding is relevant for gonadotropin quantification used in the official pharmacopoeia, which are based on murine, in vivo bioassay and rely on the evaluation of long-term, testosterone-dependent effects mediated by rodent receptor.Electronic supplementary materialThe online version of this article (doi:10.1186/s12958-016-0224-3) contains supplementary material, which is available to authorized users.

show abstract