Follicular Helper and Regulatory T Cells Drive the Development of Spontaneous Epstein–Barr Virus Lymphoproliferative Disorder

Ahmed, Elshafa Hassan; Lustberg, Mark; Hale, Claire; Sloan, Shelby; Mao, Charlene; Zhang, Xiaoli; Ozer, Hatice Gulcin; Schlotter, Sarah; Smith, Porsha L.; Jeney, Frankie; Chan, Wing Keung; Harrington, Bonnie K.; Weigel, Christoph; Brooks, Eric; Klimaszewski, Haley L.; Oakes, Christopher C.; Abebe, Tamrat; Ibrahim, Muntaser E.; Alinari, Lapo; Behbehani, Gregory K.; Shindiapina, Polina; Caligiuri, Michael A.; Baiocchi, Robert A.

doi:10.3390/cancers15113046

Cited by 2 publications

(1 citation statement)

References 74 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Each sample and the corresponding standard EBV was detected using the EBNA1 gene and performed with 10 ng of sample DNA as the initial concentration using the ViiA7 Real-time qPCR machine (Applied Biosystems, Waltham, MA USA). EBV DNA was quantified with primers specific to the EBV EBNA1 locus (forward: TCATCATCATCCGGGTCTCC, reverse: CCTACAGGGTGGAAAAATGGC), and signals were normalized to host genome DNA using primers specific for human ACTB (forward: CAGGCAGCTCGTAGCTCTTC, reverse: TCGTGCGTGACATTAAGGAG) [22]. With a total reaction volume of 10 µL, the reaction was carried out using 5 µL of 2× Fast SYBR Green Master Mix (Applied Biosystems, Waltham, MA USA), 0.25 µL of forward (10 µM) and 0.25 µL of reverse (10 µM) primers, 2.5 µL of PCR-grade water, and 2 µL of 5 ng/µL DNA concentration.…”

Section: Real-time Quantification Pcr From Genomic Dna For Ebv Load/c...mentioning

confidence: 99%

The Burden of Epstein–Barr Virus (EBV) and Its Determinants among Adult HIV-Positive Individuals in Ethiopia

Zealiyas

Teshome

Berhe

et al. 2023

Viruses

Self Cite

View full text Add to dashboard Cite

Epstein–Barr virus (EBV) is a well-known risk factor for the development of nasopharyngeal carcinoma, Hodgkin’s lymphoma (HL), and Non-Hodgkin’s lymphoma (NHL). People with HIV infection (PWH) are at increased risk for EBV-associated malignancies such as HL and NHL. Nevertheless, there are limited data on the burden of EBV among this population group in Ethiopia. Hence, this study aimed to determine the burden of EBV infection among adult HIV-positive individuals in Ethiopia and assess the determinants of EBV DNA positivity. We conducted a cross-sectional study at the Tikur Anbessa Specialised Hospital from March 2020 to March 2021. Two hundred and sixty individuals were enrolled in this study, including 179 HIV-positive and 81 HIV-negative individuals. A structured questionnaire was used to capture demographic and individual attributes. In addition, the clinical data of patients were also retrieved from clinical records. EBV viral capsid antigen (VCA) IgG antibody was measured by multiplex flow immunoassay, and EBV DNA levels were tested by quantitative real-time polymerase chain reaction (q-PCR) assays targeting the EBNA-1 open reading frame (ORF). Descriptive statistics were conducted to assess each study variable. A multivariable logistic regression model was applied to evaluate the determinants of EBV infection. Statistical significance was determined at a p-value < 0.05. Two hundred and fifty-three (97.7%) study participants were seropositive for the EBV VCA IgG antibody. Disaggregated by HIV status, 99.4% of HIV-positive and 93.8% of HIV-negative participants were EBV seropositive. In this study, 49.7% of HIV-positive and 24.7% of HIV-negative individuals were EBV DNA positive. PWH had a higher risk of EBV DNA positivity at 3.05 times (AOR: 3.05, 95% CI: 1.40–6.67). Moreover, among PWH, those with an HIV viral load greater than 1000 RNA copies/mL (AOR = 5.81, 95% CI = 1.40, 24.13) had a higher likelihood of EBV DNA positivity. The prevalence of EBV among PWH was significantly higher than among HIV-negative individuals. Higher HIV viral loads in PWH were associated with an increased risk of EBV DNA positivity. Since the increases in the viral load of EBV DNA among PWH could be related to the risk of developing EBV-associated cancers, it is necessary for more research on the role of EBV in EBV-associated cancer in this population group to be carried out.

show abstract

Section: Real-time Quantification Pcr From Genomic Dna For Ebv Load/c...mentioning

confidence: 99%

The Burden of Epstein–Barr Virus (EBV) and Its Determinants among Adult HIV-Positive Individuals in Ethiopia

Zealiyas

Teshome

Berhe

et al. 2023

Viruses

Self Cite

View full text Add to dashboard Cite

show abstract

Humanized Mouse Models of Bacterial Infections

McDonald,

Rodriguez,

Muthukrishnan

2024

Antibiotics

View full text Add to dashboard Cite

Bacterial infections continue to represent a significant healthcare burden worldwide, causing considerable mortality and morbidity every year. The emergence of multidrug-resistant bacterial strains continues to rise, posing serious risks to controlling global disease outbreaks. To develop novel and more effective treatment and vaccination programs, there is a need for clinically relevant small animal models. Since multiple bacterial species have human-specific tropism for numerous virulence factors and toxins, conventional mouse models do not fully represent human disease. Several human disease characteristic phenotypes, such as lung granulomas in the case of Mycobacterium tuberculosis infections, are absent in standard mouse models. Alternatively, certain pathogens, such as Salmonella enterica serovar typhi and Staphylococcus aureus, can be well tolerated in mice and cleared quickly. To address this, multiple groups have developed humanized mouse models and observed enhanced susceptibility to infection and a more faithful recapitulation of human disease. In the last two decades, multiple humanized mouse models have been developed to attempt to recapitulate the human immune system in a small animal model. In this review, we first discuss the history of immunodeficient mice that has enabled the engraftment of human tissue and the engraftment methods currently used in the field. We then highlight how humanized mouse models successfully uncovered critical human immune responses to various bacterial infections, including Salmonella enterica serovar Typhi, Mycobacterium tuberculosis, and Staphylococcus aureus.

show abstract

Follicular Helper and Regulatory T Cells Drive the Development of Spontaneous Epstein–Barr Virus Lymphoproliferative Disorder

Cited by 2 publications

References 74 publications

The Burden of Epstein–Barr Virus (EBV) and Its Determinants among Adult HIV-Positive Individuals in Ethiopia

The Burden of Epstein–Barr Virus (EBV) and Its Determinants among Adult HIV-Positive Individuals in Ethiopia

Humanized Mouse Models of Bacterial Infections

Contact Info

Product

Resources

About