Formation of amino acid-derived volatile compounds in dry-cured mackerel (Scomberomorus niphonius): Metabolic pathways involving microorganisms, precursors, and intermediates

Yang, Juan; Wu, Siliang; Mai, Ruijie; Lin, Li; Zhao, Wei; Bai, Weidong

doi:10.1016/j.foodchem.2021.130163

Cited by 28 publications

(15 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The reaction conditions of PCR were referred to the method of Yang et al . (2021). A MiSeq PE300 Illumina instrument (Illumina, San Diego, CA, USA) was used for the PCR sequencing by Meiji Biotech Co., Ltd. (Shanghai, China).…”

Section: Methodsmentioning

confidence: 99%

“…The primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were used for the amplification of the 16 s rDNA full length of bacterial. The reaction conditions of PCR were referred to the method of Yang et al (2021). A MiSeq PE300 Illumina instrument (Illumina, San Diego, CA, USA) was used for the PCR sequencing by Meiji Biotech Co., Ltd. (Shanghai, China).…”

Section: Dna Extraction and Pcr Amplificationmentioning

confidence: 99%

“…Dry curing is a common process used in the preservation of fish products with many benefits such as improving flavour and taste and enhancing nutritional value. Dry‐cured Spanish mackerel (DSM), a commercially popular food, is produced with a combination of salt curing (1 or 2 days) and air drying (1–5 days) (Wu et al ., 2021; Yang et al ., 2021). Literature has indicated that DSM has a unique salty and umami taste resusslting from the umami peptides and amino acids (Wang et al ., 2022).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Umami and umami‐enhancing peptides from myofibrillar protein hydrolysates in low‐sodium dry‐cured Spanish mackerel (Scomberomorus niphonius) under the action of Lactobacillus plantarum

Bai

Liang

Zhao

et al. 2022

Int J of Food Sci Tech

Self Cite

View full text Add to dashboard Cite

Summary Lactobacillus plantarum was involved in producing low‐salt (2%, w/w) dry‐cured Spanish mackerel, and its effect on the degradation of myofibrillar protein and production of umami peptides was investigated. Results showed that the dominant microbiome of the sample was Lactobacillus plantarum, accounting for 95.7% of the microbial community. The umami peptides in this dry‐cured mackerel were extracted and separated by ultra‐filtration and gel filtration chromatography and further identified by Nano‐LC–MS/MS. Five umami‐enhancing peptides, including TFYNELRV (1040 Da), TFYNELR (941 Da), TLFQPSF (838 Da), LYANNVL (805 Da) and FAGDDAPRAVFPS (1348 Da), were identified to be derived from myofibrillar protein, and the percentage of their hydrophobic amino acid were 42.85%, 33.33%, 57.14%, 57.14% and 53.84%, respectively. The synthetic peptides of these five umami peptides showed an umami‐enhancing threshold value ranging from 0.34 to 0.45 mg mL−1 through sensory evaluation. The SDS‐PAGE analysis exhibited that actin band intensity was decreased during the processing of dry‐cured mackerel. Therefore, Lactobacillus plantarum has the potential to improve the hydrolysis of myofibrillar protein to produce umami peptides in dry‐cured mackerel.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Dna Extraction and Pcr Amplificationmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Umami and umami‐enhancing peptides from myofibrillar protein hydrolysates in low‐sodium dry‐cured Spanish mackerel (Scomberomorus niphonius) under the action of Lactobacillus plantarum

Bai

Liang

Zhao

et al. 2022

Int J of Food Sci Tech

Self Cite

View full text Add to dashboard Cite

show abstract

“…145−149 For example, 3-methylbutanol, 3-methylbutanal, and phenyl- acetaldehyde, as amino acid-derived volatile compounds, could be formed in the process of dry-cured mackerel by the transaminases and decarboxylases of Staphylococcus, Bacillus, Lactobacillus, Macrococcus, and Enterobacter. 150 Some metabolic products were directly related to the spoilage and deterioration of aquatic products, which could be determined to monitor the freshness of food products. 151 For example, biogenic and volatile amines are produced by the decomposition of amino acids in living organisms, which can indicate the quality and freshness of aquatic products.…”

Section: Cereal Productsmentioning

confidence: 99%

Perovskite Nanocrystals: Superior Luminogens for Food Quality Detection Analysis

Li,

Cui,

Shi

et al. 2024

J. Agric. Food Chem.

View full text Add to dashboard Cite

With the global limited food resources receiving grievous damage from frequent climate changes and ascending global food demand resulting from increasing population growth, perovskite nanocrystals with distinctive photoelectric properties have emerged as attractive and prospective luminogens for the exploitation of rapid, easy operation, low cost, highly accurate, excellently sensitive, and good selective biosensors to detect foodborne hazards in food practices. Perovskite nanocrystals have demonstrated supreme advantages in luminescent biosensing for food products due to their high photoluminescence (PL) quantum yield, narrow full width at half-maximum PL, tunable PL in the entire visible spectrum, easy preparation, and various modification strategies compared with conventional semiconductors. Herein, we have carried out a comprehensive discussion concerning perovskite nanocrystals as luminogens in the application of high-performance biosensing of foodborne hazards for food products, including a brief introduction of perovskite nanocrystals, perovskite nanocrystal-based biosensors, and their application in different categories of food products. Finally, the challenges and opportunities faced by perovskite nanocrystals as superior luminogens were proposed to promote their practicality in the future food supply.

show abstract

“…This method also displays a particularly high sensitivity (at the ppb level) [ 8 , 9 ] and fast detection [ 10 ]. Therefore, GC-IMS is promising for identifying product varieties, carrying out quality control, monitoring product freshness, and estimating product shelf lives [ 11 , 12 , 13 ]. Previously, HS-GC-IMS and HS-SPME-GC-MS have been used to reveal the fingerprints and changes in the aroma of soybeans during fermentation, wherein 115 volatile organic compounds were successfully identified.…”

Section: Introductionmentioning

confidence: 99%

Changes of Volatile Flavor Compounds in Large Yellow Croaker (Larimichthys crocea) during Storage, as Evaluated by Headspace Gas Chromatography–Ion Mobility Spectrometry and Principal Component Analysis

Zhao

Benjakul

Sanmartin

et al. 2021

Foods

View full text Add to dashboard Cite

The large yellow croaker is one of the most economically important fish in Zhoushan, Zhejiang Province, and is well known for its high protein and fat contents, fresh and tender meat, and soft taste. However, the mechanisms involved in its flavor changes during storage have yet to be revealed, although lipid oxidation has been considered to be one important process in determining such changes. Thus, to explore the changes in the flavor of large yellow croaker fish meat during different storage periods, the main physical and chemical characteristics of the fish meat, including the acid value, peroxide value, p-anisidine value, conjugated diene value, and identities of the various flavor substances, were investigated and analyzed by multivariable methods, including headspace gas chromatography–ion mobility spectrometry (GC-IMS) and principal component analysis (PCA). It was found that after 60 d storage, the types and contents of the aldehyde and ketone aroma components increased significantly, while after 120 d, the contents of ketones (2-butanone), alcohols (1-propanethiol), and aldehydes (n-nonanal) decreased significantly. More specifically, aldehyde components dominated over ketones and lipids, while the n-nonanal content showed a downward trend during storage, and the 3-methylbutanol (trimer), 3-methylbutanol (dimer, D), 3-pentanone (D), and 3-pentanone (monomer) contents increased, whereas these compounds were identified as the key components affecting the fish meat flavor. Furthermore, after 120 d storage, the number of different flavor components reached its highest value, thereby confirming that the storage time influences the flavor of large yellow croaker fish. In this context, it should be noted that many of these compounds form through the Maillard reaction to accelerate the deterioration of fish meat. It was also found that after storage for 120 d, the physical indices of large yellow croaker meat showed significant changes, and its physicochemical properties varied. These results therefore demonstrate that a combination of GC-IMS and PCA can be used to identify the differences in flavor components present in fish meat during storage. Our study provides useful knowledge for understanding the different flavors associated with fish meat products during and following storage.

show abstract

Formation of amino acid-derived volatile compounds in dry-cured mackerel (Scomberomorus niphonius): Metabolic pathways involving microorganisms, precursors, and intermediates

Cited by 28 publications

References 33 publications

Umami and umami‐enhancing peptides from myofibrillar protein hydrolysates in low‐sodium dry‐cured Spanish mackerel (Scomberomorus niphonius) under the action of Lactobacillus plantarum

Umami and umami‐enhancing peptides from myofibrillar protein hydrolysates in low‐sodium dry‐cured Spanish mackerel (Scomberomorus niphonius) under the action of Lactobacillus plantarum

Perovskite Nanocrystals: Superior Luminogens for Food Quality Detection Analysis

Changes of Volatile Flavor Compounds in Large Yellow Croaker (Larimichthys crocea) during Storage, as Evaluated by Headspace Gas Chromatography–Ion Mobility Spectrometry and Principal Component Analysis

Contact Info

Product

Resources

About