Formation of HERV-K and HERV-Fc1 Envelope Family Members is Suppressed on Transcriptional and Translational Level

Abstract

The human genome comprises 8% sequences of retroviral origin, so-called human endogenous retroviruses (HERVs). Most of these proviral sequences are defective, but some possess open reading frames. They can lead to the formation of viral transcripts, when activated by intrinsic and extrinsic factors. HERVs are thought to play a pathological role in inflammatory diseases and cancer. Since the consequences of activated proviral sequences in the human body are largely unexplored, selected envelope proteins of human endogenous retroviruses associated with inflammatory diseases, namely HERV-K18, HERV-K113, and HERV-Fc1, were investigated in the present study. A formation of glycosylated envelope proteins was demonstrated in different mammalian cell lines. Nevertheless, protein maturation seemed to be incomplete as no transport to the plasma membrane was observed. Instead, the proteins remained in the ER where they induced the expression of genes involved in unfolded protein response, such as HSPA5 and sXBP1. Furthermore, low expression levels of native envelope proteins were increased by codon optimization. Cell-free expression systems showed that both the transcriptional and translational level is affected. By generating different codon-optimized variants of HERV-K113 envelope, the influence of single rare t-RNA pools in certain cell lines was demonstrated. The mRNA secondary structure also appears to play an important role in the translation of the tested viral envelope proteins. In summary, the formation of certain HERV proteins is basically possible. However, their complete maturation and thus full biologic activity seems to depend on additional factors that might be disease-specific and await elucidation in the future.

Endogenous Retroviral–K Envelope Is a Novel Tumor Antigen and Prognostic Indicator of Renal Cell Carcinoma

“…In addition, HEK293 and MZ1257RC cells transfected with the ERV-K113 env gene showed opposite functional phenotypes for proliferation and invasion, where HEK293 cells possibly overcompensated high ERV-K113 env protein levels restricting invasion, whereas in MZ1257RC the restriction was lost. One possible contributing mechanism of restriction may stem from translational processing occurring in the Golgi or ER, which was shown previously for HEK293 cells upon transfection with the same codon optimized overexpressing vector containing the ERV-K113 env gene (35). Important signaling pathways identified in the literature could explain ERV-K113 env protein regulation of proliferation and invasion.…”

“…Primers for three reference genes, 18S-rRNA, TF 5' GCAATTATTCCCCATGAACG, BR 5' GGCCTCACTAAAC CATCCAA; ß-actin, TF 5' TCACCATTGGCAATGAGCGG, BR 5' GATGTCCACGTCACACTTCAT; and RPS23, TF 5' TGGAGGTGCTTCTCATGCAAA, BR 5' TAATGGCAGAA TTTGGCTGTTTG were used for normalization according to MIQE guidelines (34). Additionally, note that primers specifically detecting the transfected codon optimized ERV-K113 env gene did not hybridize with the endogenous ERV-K env gene (35).…”

“…Transfection and 5'-Aza-2'deoxycytidineTreatment of Cells HEK293 and MZ1257RC cells were seeded at 450,000 or 250,000 cells per 95 mm 2 tissue culture dish, respectively, and the next day transfected either with 3 µg of the codon optimized overexpressing vector with a ERV-K113 env gene (35) or with the control pcDNA3.1 vector (Invitrogen) using JetPei (Polyplus). A pEGFP-N1 vector (Clontech) (3 µg) was transfected and confirmed a transfection efficiency >80% for both cell lines.…”

Ancient Adversary – HERV-K (HML-2) in Cancer

“…This may limit protein translation from mRNA. Codon optimisation of HML-2 env enhanced translation efficiency relative to the corresponding wild-type sequences in vitro ( 64 ).…”

Overexpression of Endogenous Retroviruses and Malignancy Markers in Neuroblastoma Cell Lines by Medium-Induced Microenvironmental Changes

“…During their long persistence in the genome, the proviruses suffered from multiple inactivation or silencing mechanisms that lead to disruption of open reading frames (ORF) by mutations and to defective protein products in nearly all human HERV (5). Nevertheless, there are few HERV with almost complete ORF, which are able to form functional proteins even if their intracellular trafficking seems to be inefficient (6).…”