Formation of oxygenated polycyclic aromatic hydrocarbons from polycyclic aromatic hydrocarbons during aerobic activated sludge treatment and their removal process

Qiao, Meng; Qi, Weixiao; Liu, Huijuan; Bai, Yaohui; Qu, Jiuhui

doi:10.1016/j.cej.2016.04.139

Cited by 30 publications

(8 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Among biological treatment methods, activated sludge processes, sequencing batch reactors and membrane bioreactors have been most commonly applied in organic pollutants removal. Qiao et al (2016) reported that the abatement efficiency of lower molecular weight organic pollutants was much higher than high molecular weight organic pollutants because the lower molecular weight organic pollutants could be more easily biodegraded/biotrans formed during biological treatment. reported that the total abatement of ΣNPAHs in summer reached 63.22% to 63.58% in a municipal biological wastewater treatment plant.…”

Section: Removal Of Pahs From Aqueous Solutionsmentioning

confidence: 99%

Comprehensive review of polycyclic aromatic hydrocarbons in water sources, their effects and treatments

Mojiri

Zhou

Ohashi

et al. 2019

Science of The Total Environment

435

154

View full text Add to dashboard Cite

Polycyclic aromatic hydrocarbons (PAHs) are principally derived from the incomplete combustion of fossil fuels. This study investigated the occurrence of PAHs in aquatic environments around the world, their effects on the environment and humans, and methods for their removal. Polycyclic aromatic hydrocarbons have a great negative impact on the environment and humans, and can even cause cancer in humans. Use of good methods and equipment are essential to monitoring PAHs, and GC/MS and HPLC are usually used for their analysis in aqueous solutions. In aquatic environments, the PAHs concentrations range widely from 0.03 ng/L (seawater; Southeastern Japan Sea, Japan) to 8,310,000 ng/L (Domestic Wastewater Treatment Plant, Siloam, South Africa). Moreover, bioaccumulation of ∑16PAHs in fish has been reported to range from 11.2 ng/L (Cynoscion guatucupa, South Africa) to 4207.5 ng/L (Saurida undosquamis, Egypt). Several physical/chemical and biological techniques have been reported to treat water contaminated by PAHs, but adsorption and combined treatment methods have shown better removal performance, with some methods removing up to 99.99% of PAHs.

show abstract

Section: Removal Of Pahs From Aqueous Solutionsmentioning

confidence: 99%

Comprehensive review of polycyclic aromatic hydrocarbons in water sources, their effects and treatments

Mojiri

Zhou

Ohashi

et al. 2019

Science of The Total Environment

435

154

View full text Add to dashboard Cite

show abstract

“…DNA extraction and sequencing DNA was extracted from 5 g freeze-dried soil using the MoBIO PowerSoil DNA Isolation Kit (Carlsbad, CA). The V3V4 region of bacterial 16S rRNA was ampli ed using primers 515F and 806R (Caporaso et al 2012); for fungi, the fungal internal transcribed spacer (ITS) region was ampli ed using primer ITS3-F GCATCGATGAAGAACGCAGC and ITS4-R TCCTCCGCTTATTGATATGC (Prober et al 2015;Qiao et al 2016). PCR was conducted on 20 ng/ul of template DNA employing an initial denaturation of 5 min at 94°C, followed by ( 30for 16S and 30 cycles for ITS) 30 s at 94°C, 30 s at 52°C and 30 s at 72°C; followed by 10 min nal elongations at 72°C.…”

Section: Determining Soil Physicochemical Parametersmentioning

confidence: 99%

Changes in Soil Microbial Community Structure and Functional Genes Following with Different Functional Traits Species Afforestation

Gao¹,

Wang²,

Z³

et al. 2021

Preprint

View full text Add to dashboard Cite

Aim Soil microbial community structure and functional genes are critical to the cycling of carbon and nutrients in forest soils. As afforestation practices increasingly promote different functional traits tree species, it becomes critical to understand how they influences soil microbial community structures and functional genes, which directly influence soil biogeochemical processes. Methods We used fungi ITS and bacteria 16S rDNA to investigate soil microbial communities and functional genes in three monoculture plantations consisting of a non-native evergreen conifer (Pinus sibirica), a native deciduous conifer (Larix gmelinii), and a native deciduous angiosperm (Betula platyphylla) to compare with two 1:1 mixed-species plantations (P. sibirica and L. gmelinii, P. sibirica and B. platyphylla).Results The fungal community structure of the conifer-angiosperm mixed plantation was similar to that of the non-native evergreen conifer, and the bacterial community structure was similar to that of the angiosperm monoculture plantation. Fungal communities were strongly related to tree species, but bacteria communities were strongly related to soil nitrogen. Microbial co-occurrence patterns varied according to plantation types and altered soil nutrient cycling. Microbial communities in forest plantations of conifer-angiosperm mixed plantation contribute to soil nitrogen fixation and coniferous mixed plantation contribute to soil carbon fixation. Conclusions Our results provide a comparative study of the soil microbial ecology in afforestation of different functional trains species. This knowledge enhances the understanding of the relative control of soil microbial community structure.

show abstract

“…NPAHs and Me-PAHs may be released from similar sources of PAHs, for instance, incomplete combustion, vehicle engines, and spillage oil [ 5 ]. The derivatives can also be produced through the transformation of polycyclic aromatic hydrocarbons equivalent to different rings by chemical and biological processes [ 6 ]. NPAHs present in the aquatic environment could also be obtained from atmospheric deposition and urban drainage [ 7 ].…”

Section: Introductionmentioning

confidence: 99%

Occurrence, Removal, and Mass Balance of Polycyclic Aromatic Hydrocarbons and Their Derivatives in Wastewater Treatment Plants in Northeast China

Mohammed

Zhang

Jiang

et al. 2021

Toxics

View full text Add to dashboard Cite

polycyclic aromatic hydrocarbons (PAHs), 33 Methylated PAHs (Me-PAHs), and 14 nitrated PAHs (NPAHs) were measured in wastewater treatment plants (WWTPs) to study the removal efficiency of these compounds through the WWTPs, as well as their source appointment and potential risk in the effluent. The concentrations of ∑PAHs, ∑Me-PAHs, and ∑NPAHs were 2.01–8.91, 23.0–102, and 6.21–171 µg/L in the influent, and 0.17–1.37, 0.06–0.41 and 0.01–2.41 µg/L in the effluent, respectively. Simple Treat 4.0 and meta-regression methods were applied to calculate the removal efficiencies (REs) for the 63 PAHs and their derivatives in 10 WWTPs and the results were compared with the monitoring data. Overall, the ranges of REs were 55.3–95.4% predicated by the Simple Treat and 47.5–97.7% by the meta-regression. The results by diagnostic ratios and principal component analysis PCA showed that “mixed source” biomass, coal composition, and petroleum could be recognized to either petrogenic or pyrogenic sources. The risk assessment of the effluent was also evaluated, indicating that seven carcinogenic PAHs, Benzo[a]pyrene, Dibenz[a,h]anthracene, and Benzo(a)anthracene were major contributors to the toxic carcinogenic equivalents (TEQs) in the effluent of WWTPs, to which attention should be paid.

show abstract

Formation of oxygenated polycyclic aromatic hydrocarbons from polycyclic aromatic hydrocarbons during aerobic activated sludge treatment and their removal process

Cited by 30 publications

References 28 publications

Comprehensive review of polycyclic aromatic hydrocarbons in water sources, their effects and treatments

Comprehensive review of polycyclic aromatic hydrocarbons in water sources, their effects and treatments

Changes in Soil Microbial Community Structure and Functional Genes Following with Different Functional Traits Species Afforestation

Occurrence, Removal, and Mass Balance of Polycyclic Aromatic Hydrocarbons and Their Derivatives in Wastewater Treatment Plants in Northeast China

Contact Info

Product

Resources

About