Founder mutations in early-onset, familial and bilateral breast cancer patients from Russia

Sokolenko, Anna P.; Rozanov, Maxim E.; Mitiushkina, Natalia V.; Sherina, Natalia; Iyevleva, Aglaya G.; Chekmariova, Elena V.; Buslov, Konstantin G.; Shilov, E. S.; Togo, Alexandr V.; Bit-Sava, E.M.; Voskresenskiy, Dmitry A.; Chagunava, Oleg L.; Devilee, Peter; Cornelisse, Cees J.; Семиглазов, Владимир; Imyanitov, Evgeny N.

doi:10.1007/s10689-007-9120-5

Cited by 69 publications

(52 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Sequencing of TP53 gene detected similar frequency of mutations in biBC and [48], are designated by asterisks. BRCA1 status assessment was done in all patients irrespectively of their age or family history; it included testing for three founder mutations (5382insC, 4153delA, and 185delAG), which constitute over 90% BRCA1 defects in Russia [49,50] uBC; however, tumors from synchronous biBC pairs tended to contain multiple nucleotide alterations within this gene, that was interpreted as potential indicator of genotoxic stress or failed genome defense [12]. A subset of contralateral neoplasms from metachronous biBC, but not other categories of breast tumors, were shown to have the so-called microsatellite instability phenotype (MSI-H); this observation was linked to the mutagenic effect of the adjuvant therapy applied for the treatment of the first malignancy [11].…”

Section: Discussionmentioning

confidence: 99%

High level of miR-21, miR-10b, and miR-31 expression in bilateral vs. unilateral breast carcinomas

Iyevleva

Kuligina

Mitiushkina

et al. 2011

Breast Cancer Res Treat

Self Cite

View full text Add to dashboard Cite

We analyzed the expression of several microRNAs (miRs) implicated in breast cancer (BC) pathogenesis (miR-21, miR-10b, miR17-5p, mir-31, miR-155, miR-200c, miR-18a, miR-205, and miR-27a) in 80 breast carcinomas obtained from patients with bilateral BC (biBC) and 40 cases of unilateral BC (uBC). Unexpectedly, three miRs (miR-21, miR-10b and miR-31) demonstrated significantly higher level of expression in biBC vs. uBC (P = 0.0001, 0.00004 and 0.0002, respectively). Increased contents of miR-21, miR-10b and miR-31 were observed in all categories of biBC tumors, i.e., in synchronous biBC as well as in first and second tumors from metachronous biBC cases. Synchronous biBC showed more similarity of miR expression profiles within pairs that the metachronous doublets (P = 0.004). This study suggests that bilateral breast tumors have somewhat distinct pattern of molecular events as compared to the unilateral disease.

show abstract

Section: Discussionmentioning

confidence: 99%

High level of miR-21, miR-10b, and miR-31 expression in bilateral vs. unilateral breast carcinomas

Iyevleva

Kuligina

Mitiushkina

et al. 2011

Breast Cancer Res Treat

Self Cite

View full text Add to dashboard Cite

show abstract

“…3). Testing for Russian breast cancer-associated founder mutations was performed as described by Sokolenko et al [3] and revealed BRCA1 5382insC heterozygote (Fig. 4).…”

Section: Genetic Analysismentioning

confidence: 99%

“…Products were analyzed in 12% non-denaturing polyacrylamide gel. In addition, the kinetics of accumulation of mutant and wild-type BRCA1 fragments were examined by allele-specific PCR (iCycler iQ Real Time Detection System, Bio-Rad) with SYBR Green I using primers AAGCGAGCAAGAGAATTCCAG (specific for the wild-type allele), AGCGAGCAAGAGA ATTCCCA (specific for the mutated allele), and AGAACCT GTGTGAAAGTATCTAGCACTG (common primer) [3].…”

Section: Genetic Analysismentioning

confidence: 99%

Mixed epithelial/mesenchymal metaplastic carcinoma (carcinosarcoma) of the breast in BRCA1 carrier

et al. 2009

Self Cite

View full text Add to dashboard Cite

This case report describes a 35-year-old woman who was diagnosed with mixed epithelial/mesenchymal metaplastic carcinoma (carcinosarcoma) of the breast. Genetic analysis of blood DNA revealed a common founder mutation, BRCA1 5382insC. Examination of microdissected tumor samples determined that both epithelial and mesenchymal components contained deletion of the wild-type BRCA1 allele. This report exemplifies that even very uncommon breast tumor types may develop through biallelic inactivation of BRCA1 gene, that has to be considered in the genetic testing settings.

show abstract

“…Petrov Institute of Oncology (St.-Petersburg) within years [10][11][12][13]. In addition, we considered previously obtained results of the analysis of entire BRCA1-coding region [14].…”

Section: Methodsmentioning

confidence: 99%

Breast cancer sensitivity to neoadjuvant therapy in BRCA1 and CHEK2 mutation carriers and non-carriers

Pfeifer

Sokolenko

Potapova

et al. 2014

Breast Cancer Res Treat

Self Cite

View full text Add to dashboard Cite

Breast carcinomas caused by inheritance of cancer-predisposing germ-line mutations have specific bioclinical features. This study aimed to analyze the efficacy of conventional cytotoxic treatment in BRCA1 and CHEK2 mutation carriers and non-carriers. The study included 415 Russian breast cancer patients aged 50 years or younger, who were subjected to various standard schemes of neoadjuvant therapy. The choice of therapy was done without the knowledge of the mutations status, because DNA testing was performed retrospectively using the archival tissue samples. 19 BRCA1 (4.6%) and 8 CHEK2 (1.9%) heterozygous genotypes were identified. BRCA1 mutation carriers achieved pathological complete response more frequently than non-carriers [6/19 (31.6%) vs. 46/388 (11.9%), p = 0.024]; this effect was limited to women treated by anthracycline-based therapy without taxanes [5/9 (55.6%) vs. 28/247 (11.3%), p = 0.002] and was not observed in any of 7 BRCA1 carriers receiving taxane-containing regimens. CHEK2 heterozygotes did not experience pathological complete response and showed lower frequency of objective clinical responses as compared to mutation non-carriers [4/8 (50%) vs. 333/388 (85.5%), p = 0.020]; the efficacy of neoadjuvant therapy was particularly poor in CHEK2 carriers receiving anthracyclines without taxanes. This study provides evidence for distinct sensitivity of BRCA1 and CHEK2 mutation-driven breast carcinomas to standard chemotherapeutic schemes.

show abstract

Founder mutations in early-onset, familial and bilateral breast cancer patients from Russia

Cited by 69 publications

References 20 publications

High level of miR-21, miR-10b, and miR-31 expression in bilateral vs. unilateral breast carcinomas

High level of miR-21, miR-10b, and miR-31 expression in bilateral vs. unilateral breast carcinomas

Mixed epithelial/mesenchymal metaplastic carcinoma (carcinosarcoma) of the breast in BRCA1 carrier

Breast cancer sensitivity to neoadjuvant therapy in BRCA1 and CHEK2 mutation carriers and non-carriers

Contact Info

Product

Resources

About