Fruiting body formation by Bacillus subtilis

Abstract

Spore formation by the bacterium Bacillus subtilis has long been studied as a model for cellular differentiation, but predominantly as a single cell. When analyzed within the context of highly structured, surface-associated communities (biofilms), spore formation was discovered to have heretofore unsuspected spatial organization. Initially, motile cells differentiated into aligned chains of attached cells that eventually produced aerial structures, or fruiting bodies, that served as preferential sites for sporulation. Fruiting body formation depended on regulatory genes required early in sporulation and on genes evidently needed for exopolysaccharide and surfactin production. The formation of aerial structures was robust in natural isolates but not in laboratory strains, an indication that multicellularity has been lost during domestication of B. subtilis. Other microbial differentiation processes long thought to involve only single cells could display the spatial organization characteristic of multicellular organisms when studied with recent natural isolates.

Evolution of exploitative interactions during diversification in Bacillus subtilis biofilms

“…Strains were maintained in Lysogeny broth (LB) medium (LB-Lennox, Carl Roth; 10 g/L tryptone, 5 g/L yeast extract, and 5 g/L NaCl), while MSgg medium was used for biofilm induction (Branda et al 2001).…”

“…9, 2017; 5 diversification in biofilms of Gram-positive bacteria has not received much attention. Bacillus subtilis is a wide spread, plant growth promoting spore-former, known from its ability to form complex pellicle biofilms at the liquid-air interface (Branda et al 2001). Previous studies already indicated that this bacterium readily diversifies into distinct colony types when cultivated under static or planktonic conditions (Leiman et al 2014).…”

Bacteria are small but not stupid: cognition, natural genetic engineering and socio-bacteriology

“…Consequently, B. subtilis sporulation has traditionally been studied as an autonomous single-cell event. That unicellular focus changed, however, with the identification of two separate extracellular signals needed to initiate sporulation (Grossman & Losick, 1988) and the discovery that wild-type B. subtilis colonies contain morphologically distinct fruiting bodies where sporulation occurs (Branda et al, 2001). In addition to intercellular communication at the start of B. subtilis sporulation, another signaling system was discovered that controls programmed cell death of non-sporulating cells in the fruiting body at a later stage of the process (GonzalezPastor et al, 2003).…”

Activity Screening of Carrier Domains within Nonribosomal Peptide Synthetases Using Complex Substrate Mixtures and Large Molecule Mass Spectrometry

“…The resulting PCR product was cloned in frame with the carboxy-6xHis fusion at the NcoI and XhoI restriction sites of pET28a. The pksN and pksJ didomains were cloned in a similar fashion from the Bacillus subtilis strain NCIB 3610 (49). The pksJ-AT2 didomain was amplified using primers: Forward 5' AGCTAGCTTTGAACTGTGGGAAACAGA 3' and reverse 5' ACTCGAGTCATTTTTGCAATGTCCATAATCC 3'.…”