2020
DOI: 10.3390/cells9030738
|View full text |Cite
|
Sign up to set email alerts
|

Function of Torsin AAA+ ATPases in Pseudorabies Virus Nuclear Egress

Abstract: Newly assembled herpesvirus nucleocapsids traverse the intact nuclear envelope by a vesicle-mediated nucleo-cytoplasmic transport for final virion maturation in the cytoplasm. For this, they bud at the inner nuclear membrane resulting in primary enveloped particles in the perinuclear space (PNS) followed by fusion of the primary envelope with the outer nuclear membrane (ONM). While the conserved viral nuclear egress complex orchestrates the first steps, effectors of fusion of the primary virion envelope with t… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
2
1

Citation Types

0
15
0

Year Published

2021
2021
2023
2023

Publication Types

Select...
6
1

Relationship

3
4

Authors

Journals

citations
Cited by 9 publications
(15 citation statements)
references
References 78 publications
(139 reference statements)
0
15
0
Order By: Relevance
“…Overexpression of a dominantnegative SUN2 resulted in accumulations of primary virions in a dilated PNS, indicating that SUN2 in the LINC complex keeps the membranes at a certain distance to allow for efficient membrane fusion [29]. In line with this, an accumulation of primary virions was found in cells deficient for the AAA + ATPases Torsin A and B with a possible impact on scission of the primary enveloped particles from the INM [30]. Torsin A is reported to be involved in LINC complex assembly and/or disassembly [31,32], again pointing to a role for the LINC complex in nuclear egress.…”
Section: Introductionmentioning
confidence: 69%
See 1 more Smart Citation
“…Overexpression of a dominantnegative SUN2 resulted in accumulations of primary virions in a dilated PNS, indicating that SUN2 in the LINC complex keeps the membranes at a certain distance to allow for efficient membrane fusion [29]. In line with this, an accumulation of primary virions was found in cells deficient for the AAA + ATPases Torsin A and B with a possible impact on scission of the primary enveloped particles from the INM [30]. Torsin A is reported to be involved in LINC complex assembly and/or disassembly [31,32], again pointing to a role for the LINC complex in nuclear egress.…”
Section: Introductionmentioning
confidence: 69%
“…The sgRNA expressing plasmids were co-transfected into RK13 cells to enhance the efficiency of the knockout and to increase the chance to introduce larger deletions, specifically aiming for out-of-frame mutations to ensure absence of protein expression. Using this approach we already generated Torsin A and Torsin B single as well as double knockout cells [30].…”
Section: Discussionmentioning
confidence: 99%
“…In addition, we demonstrate that the ability of torsinA to promote these two cellular processes is sensitive to the presence or absence of EGFP fused to its C-terminus. Moving forward, it will be exciting to test the effects of the E171Q and ΔNTD mutations on the following torsinA-dependent processes: ER-associated protein degredation (Esapa et al, 2007; Nery et al, 2011); nuclear egress of large ribonucleoprotein granules (Jokhi et al, 2013) and herpesvirus capsids (György et al, 2018; Maric et al, 2011; Maric et al, 2014; Turner et al, 2015; Hölper et al, 2020); nuclear membrane removal from mitotic chromatin (Luithle et al, 2020); and protein secretion (Hewett et al, 2007; Hewett et al, 2008; Torres et al, 2004). Finally, it will be important to begin to determine how torsinA oligomerizes within the peripheral ER, as torsinA is thought to be able to adopt multiple oligomeric states in this subcellular compartment (Chase et al, 2017a; Goodchild et al, 2015; Jungwirth et al, 2010).…”
Section: Discussionmentioning
confidence: 99%
“…Correct cloning was verified by sequencing with primer HU6-F (ATAATTTCTTGGGTAGTTTGCAG). RK13-sgms1 KO cell lines were generated by co-transfection of all four sgRNA-containing pX330-NeoR plasmids (1.5 µg per plasmid) into cells using calcium phosphate-co-precipitation [ 57 ].…”
Section: Methodsmentioning
confidence: 99%
“…Correct cloning was verified by sequencing with primer HU6-F (ATAATTTCTTGGGTAGTTTGCAG). RK13-sgms1 KO cell lines were generated by co-transfection of all four sgRNA-containing pX330-NeoR plasmids (1.5 µg per plasmid) into cells using calcium phosphate-co-precipitation [57]. Two days after transfection in 6 well dishes, cells were transferred to 10 cm plates (Corning, Sigma-Aldrich, Darmstadt, Germany) and selected in medium containing 500 µg/mL G418 (Invitrogen, Karlsruhe, Germany).…”
Section: Methodsmentioning
confidence: 99%