Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max)

Abstract

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

“…To do so, DNA motifs are derived from conserved DNA sequences in native promoters of co-expressed genes of interest in species of interest: typically, non-model plants. Recently, several tandem repeats with unknown DNA motifs have been successfully introduced in transgenic soybean and poplar, and clearly induced downstream genes relating to nematode infection in soybean (Liu et al, 2014;Sultana et al, 2022) and abiotic stresses in poplar (Yang et al, 2021(Yang et al, , 2022b) from transcriptome analysis including na€ ıve microarray analysis. Although these synthetic promoters were activated in transgenic plants by abiotic or biotic stimuli, the responses were not specific to cell types or tissue.…”

“…The synthetic promoter structure utilizing repeats of a known CRE fused with a minimal core promoter is a rational design that usually functions as designed. To date, our colleagues have facilitated in tandem repeats of well‐known CREs fused with a short −46 CaMV 35S core promoter to produce biotic and abiotic stress‐responsible phytosensors in Arabidopsis , soybean, potato, and poplar (Liu et al ., 2014; Persad‐Russell et al ., 2022; Sears et al ., 2023; Sultana et al ., 2022;Yang et al ., 2021, 2022b). Among these studies, pathogen‐ and radiation‐sensing synthetic promoters were developed from copies of the well‐known CREs of the S‐box pathogen sensing DNA motif and the DNA recognition motif in the Arabidopsis RAD51 promoter, following the traditional process for synthetic promoter generation (Persad‐Russell et al ., 2022; Sears et al ., 2023).…”

“…Synthetic promoters are constructed with a transcription factor (TF) that recognizes a sequence containing either a re-formatted CREs or simple repeats of a conserved CRE sequence, as well as a core promoter sequence including the binding site of RNA polymerase II. This format has been employed repeatedly for applications in herbaceous and woody plant species (Cai et al, 2020;Sears et al, 2023;Sultana et al, 2022;Yang et al, 2021Yang et al, , 2022b. Short synthetic promoters composed of head-to-tail repeats of conserved CREs and fused upstream of a À 46 bp 35S promoter can result in a shorter than 100 bp and functional promoter.…”

“…Short synthetic promoters composed of head-to-tail repeats of conserved CREs and fused upstream of a À 46 bp 35S promoter can result in a shorter than 100 bp and functional promoter. For example, Sultana et al (2022) demonstrated that the synthetic promoters were induced specifically by soybean cyst nematode application in engineered soybean roots (Liu et al, This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. 2014).…”

“…For example, Sultana et al . (2022) demonstrated that the synthetic promoters were induced specifically by soybean cyst nematode application in engineered soybean roots (Liu et al ., 2014). In each of these studies, 6–7 copies of short conserved sequences were effective to induce gene expression to specific stimuli.…”