Functional cDNA libraries from Drosophila embryos

Brown, Nicholas H.; Kafatos, Fotis C.

doi:10.1016/0022-2836(88)90010-1

Cited by 607 publications

(327 citation statements)

References 36 publications

Supporting

Mentioning

322

Contrasting

Unclassified

Order By: Relevance

“…The papilin cDNA sequence that we reported in Kramerova et al (2000), was cloned from a 4 -8 hr embryo cDNA library (Brown and Kafatos, 1988). The size of the protein predicted from this sequence was smaller than that determined by gel electrophoresis of the non-O-glycosylated papilin isolated from 7E10 cells (Campbell et al, 1987).…”

Section: Structure Of the Papilin Gene And Three Different Splicevarimentioning

confidence: 89%

“…lected over 4 -8 hr (approximately developmental stages 7-11), 8 -12 hr (stages 11-early 14), and 12-24 hr (stage 14 to the end of embryonic development) after egg laying (Brown and Kafatos, 1988). By using the polymerase chain reaction (PCR) primers 1, 2, and 3 indicated in Figure 1A, we distinguished between different forms of papilin by the size of the resulting PCR products (Fig.…”

Section: Study Of the Time-dependent Regulation Of Papilin Expressionmentioning

confidence: 99%

“…For PCR analyses, plasmid DNA was isolated from random pools of cDNA libraries prepared from 4 -8 hr, 8 -12 hr, and 12-24 hr embryos (Brown and Kafatos, 1988). Two to three pools from each library were used with the following pairs of primers: (1) 5Ј AAT-GTCCAGGAGCCACCGCAAAAGG (4807-4831 bp of the coding sequence of papilin-3) and (2) 5Ј CACCAAGTTCTTGAGCGACCAGG (7661-7683 bp), which can detect all forms of papilin; (3) 5Ј and primer 2 to detect papilin-2 and papilin-3 cDNAs; (4) 5Ј CGGTGAC-CACGGGTCCGTGC (6767-6786 bp) and (5) 5Ј GAAGGATCGGAAGTTGT-TCTGG (7071-7092 bp) to detect only papilin-3 cDNA.…”

Section: Analysis Of Cdna Clones and Pcrmentioning

confidence: 99%

See 2 more Smart Citations

Alternative splicing of papilin and the diversity of Drosophila extracellular matrix during embryonic morphogenesis

Kramerova

Kramerov

Fessler

2003

Developmental Dynamics

View full text Add to dashboard Cite

Papilins are extracellular matrix proteins that share a particular, common order of types of protein domains. They occur widely, from nematodes to man, and can differ in the number of repeats of a given type of domain. Protein variety is increased by differential splicing of pre-mRNA. We report that Drosophila, which has a compact genome, expresses three splice variants of papilin during embryogenesis in developmentally defined patterns. These isoforms have different numbers of Kunitz and IgC2 domains. The papilin isoforms are expressed in specific cell types and contribute to different extracellular matrices in gastrulation folds, early mesoderm, heart formation, basement membranes, and elaboration of the excorporeal peritrophic membrane that lines the gut. This finding indicates an unexpectedly broad spectrum of different pericellular matrices in Drosophila embryos. Such papilin-containing matrices have developmental as well as functional significance, as we previously showed that both suppression of papilin synthesis and ectopic overexpression lethally disrupt organogenesis. Developmental Dynamics 226:634 -642, 2003.

show abstract

Section: Structure Of the Papilin Gene And Three Different Splicevarimentioning

confidence: 89%

Section: Study Of the Time-dependent Regulation Of Papilin Expressionmentioning

confidence: 99%

Section: Analysis Of Cdna Clones and Pcrmentioning

confidence: 99%

See 1 more Smart Citation

Alternative splicing of papilin and the diversity of Drosophila extracellular matrix during embryonic morphogenesis

Kramerova

Kramerov

Fessler

2003

Developmental Dynamics

View full text Add to dashboard Cite

show abstract

“…cDNA clones for CENP-meta and CENP-ana were isolated from a Drosophila embryonic λZAP library (Stratagene) and a Drosophila 0–4 h embryonic library (a kind gift from Nick Brown; Brown and Kafatos 1988). Some portions of cDNA were identified using reverse transcription of total RNA isolated from S2 cells (Schneider 1972) or embryos with SuperScript II (GIBCO BRL), followed by PCR amplification using either the proof-reading ELONGase enzyme (GIBCO BRL) or PFU polymerase (Stratagene) and subcloning.…”

Section: Methodsmentioning

confidence: 99%

CENP-meta, an Essential Kinetochore Kinesin Required for the Maintenance of Metaphase Chromosome Alignment in Drosophila

Yucel

Marszalek

McIntosh

et al. 2000

The Journal of Cell Biology

View full text Add to dashboard Cite

CENP-meta has been identified as an essential, kinesin-like motor protein in Drosophila. The 257-kD CENP-meta protein is most similar to the vertebrate kinetochore-associated kinesin-like protein CENP-E, and like CENP-E, is shown to be a component of centromeric/kinetochore regions of Drosophila chromosomes. However, unlike CENP-E, which leaves the centromere/kinetochore region at the end of anaphase A, the CENP-meta protein remains associated with the centromeric/kinetochore region of the chromosome during all stages of the Drosophila cell cycle. P-element–mediated disruption of the CENP-meta gene leads to late larval/pupal stage lethality with incomplete chromosome alignment at metaphase. Complete removal of CENP-meta from the female germline leads to lethality in early embryos resulting from defects in metaphase chromosome alignment. Real-time imaging of these mutants with GFP-labeled chromosomes demonstrates that CENP-meta is required for the maintenance of chromosomes at the metaphase plate, demonstrating that the functions required to establish and maintain chromosome congression have distinguishable requirements.

show abstract

“…cDNA library screening, cloning and phage DNA isolation were done according to standard protocols (Sambrook et al, 1989). The embryonic Drosophila cDNA library was a gift of S Elledge, the imaginal disc library (Brown and Kafatos, 1988) …”

Section: Dna Clones and Librariesmentioning

confidence: 99%

D-Cbl, the Drosophila homologue of the c-Cbl proto-oncogene, interacts with the Drosophila EGF receptor in vivo, despite lacking C-terminal adaptor binding sites

Hime

Dhungat

et al. 1997

Oncogene

View full text Add to dashboard Cite

The c-Cbl proto-oncogene encodes a multidomain phosphoprotein that has been demonstrated to interact with a wide range of signalling proteins. The biochemical function of c-Cbl in these complexes is, however, unclear. Recent studies with the C. elegans Cbl homologue, sli-1, have suggested that Cbl proteins may act as negative regulators of EGF receptor (EGFR) signalling. As the EGFR and other protein tyrosine kinase receptor signalling pathways are highly conserved between insects and vertebrates, we sought a Drosophila homologue of cCbl for a detailed genetic analysis. We report here that Drosophila melanogaster has a single gene, D-cbl, that is homologous to c-cbl. We ®nd that D-cbl encodes a 52 kDa protein that has a high degree of similarity to cCbl and SLI-1 across novel phosphotyrosine-binding (PTB) and RING ®nger domains. Surprisingly, however, D-Cbl is C-terminally truncated relative to c-Cbl and SLI-1 and consequently is unable to bind SH3-domain containing adaptor proteins, including the Drosophila Grb2 homologue, Drk. Although the D-Cbl protein lacks Drk binding sites it can nevertheless associate with a tyrosine phosphorylated protein, or is itself tyrosine phosphorylated in an DER dependent manner and associates with activated Drosophila EGF receptors (DER) in vivo. Consistent with a role for D-Cbl in DER dependent patterning in the embryo and adult, DCbl is expressed at a high level in early embryos and throughout the imaginal discs in third instar larvae. This study forms the basis for future genetic analysis of DCbl, aimed at gaining insights into the role of Cbl proteins in signal transduction.

show abstract

Functional cDNA libraries from Drosophila embryos

Cited by 607 publications

References 36 publications

Alternative splicing of papilin and the diversity of Drosophila extracellular matrix during embryonic morphogenesis

Alternative splicing of papilin and the diversity of Drosophila extracellular matrix during embryonic morphogenesis

CENP-meta, an Essential Kinetochore Kinesin Required for the Maintenance of Metaphase Chromosome Alignment in Drosophila

D-Cbl, the Drosophila homologue of the c-Cbl proto-oncogene, interacts with the Drosophila EGF receptor in vivo, despite lacking C-terminal adaptor binding sites

Contact Info

Product

Resources

About