Functional characterization of CYP107W1 from Streptomyces avermitilis and biosynthesis of macrolide oligomycin A

Han, Songhee; Pham, Tan‐Viet; Kim, Joohwan; Lim, Young-Ran; Park, Hyoung-Goo; Cha, Gun-Su; Yun, Chul‐Ho; Chun, Young‐Jin; Kang, Lin‐Woo; Kim, Donghak

doi:10.1016/j.abb.2015.03.025

Cited by 24 publications

(30 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Generally, the rates were rather slow, with k cat values ranging from 1.15 ± 0.02 min −1 for 9 to 0.24 ± 0.02 min −1 for 8 (Figure 3a; Table 3). Although the latter value is lower than that observed for many other P450/substrate combinations, it is close to that reported for CYP107W1, which hydroxylates a tertiary carbon atom in the 26-membered ring macrolide oligomycin C. 52 In addition, all of the rates are higher than that determined for TamI-RhFRED acting on tirandamycin A ( k cat = 0.11 ± 0.01 min −1 ), 34 which is one of the few other examples of a biosynthetic P450 that hydroxylates an unactivated primary carbon atom. The slow rates may in part be explained by the higher activation energy required to oxidize a primary C-H bond, although examples of engineered P450s that perform similar transformations more rapidly have been reported.…”

Section: Resultssupporting

confidence: 79%

“…The value for 10 (0.0127 ± 0.0006 μM −1 min −1 ) is similar to that for CYP107W1 acting on its native substrate (0.012 μM −1 min −1 ). 52 The specificity constant is ~14-fold lower for 8 (0.0009 ± 0.0002 μM −1 min −1 ), but it is still higher than that for the oxidation of tirandamycin A by TamI-RhFRED (0.00058 μM −1 min −1 ). 34 Notably, the results from these kinetics experiments are consistent with those obtained from the TTN assays, which indicate a clear preference for MycCI-RhFRED toward substrates bearing a deoxyamino sugar.…”

Section: Resultsmentioning

confidence: 92%

See 1 more Smart Citation

Biochemical and Structural Characterization of MycCI, a Versatile P450 Biocatalyst from the Mycinamicin Biosynthetic Pathway

et al. 2016

View full text Add to dashboard Cite

Cytochrome P450 monooxygenases (P450s) are some of nature’s most ubiquitous and versatile enzymes for performing oxidative metabolic transformations. Their unmatched ability to selectively functionalize inert C-H bonds has led to their increasing employment in academic and industrial settings for the production of fine and commodity chemicals. Many of the most interesting and potentially biocatalytically useful P450s come from microorganisms, where they catalyze key tailoring reactions in natural product biosynthetic pathways. While most of these enzymes act on structurally complex pathway intermediates with high selectivity, they often exhibit narrow substrate scope, thus limiting their broader application. In the present study, we investigated the reactivity of the P450 MycCI from the mycinamicin biosynthetic pathway toward a variety of macrocyclic compounds and discovered that the enzyme exhibits appreciable activity on several 16-membered ring macrolactones independent of their glycosylation state. These results were corroborated by performing equilibrium substrate binding experiments, steady-state kinetics studies, and x-ray crystallographic analysis of MycCI bound to its native substrate mycinamicin VIII. We also characterized TylHI, a homologous P450 from the tylosin pathway, and showed that its substrate scope is severely restricted compared to MycCI. Thus, the ability of the latter to hydroxylate both macrocyclic aglycones and macrolides sets it apart from related biosynthetic P450s and highlights its potential for developing novel P450 biocatalysts with broad substrate scope and high regioselectivity.

show abstract

Section: Resultssupporting

confidence: 79%

Section: Resultsmentioning

confidence: 92%

Biochemical and Structural Characterization of MycCI, a Versatile P450 Biocatalyst from the Mycinamicin Biosynthetic Pathway

et al. 2016

View full text Add to dashboard Cite

show abstract

“…The structures of some Streptomyces P450s were first published several years ago [58, 76]. Recently Han et al [77] reported a 2.1 Å structure (PDB 4WPZ) for P450 107W1, an enzyme involved in C12 hydroxylation in the biosynthesis of the macrolide oligomycin A. The substrate was not present in the crystal, but early in 2016 a new structure with the product oliomycin A has been published [78], The structure (PDB 4WQ0) indicates that Trp-178, located in the open pocket of the active site, may be a critical residue for the productive binding conformation.…”

Section: Recent Bacterial P450 Structuresmentioning

confidence: 99%

Recent Structural Insights into Cytochrome P450 Function

Guengerich

Waterman

Egli

2016

Trends in Pharmacological Sciences

290

178

View full text Add to dashboard Cite

Cytochrome P450 (P450) enzymes are important in the metabolism of drugs, steroids, fat-soluble vitamins, carcinogens, pesticides, and many other types of chemicals. Their catalytic activities are important issues in areas such as drug-drug interactions and endocrine function. During the past 30 years, structures of P450s have been very helpful in understanding function, particularly the mammalian P450 structures available in the past 15 years. We review recent activity in this area, focusing on the past two years (2014–2015). Structural work with microbial P450s includes studies related to the biosynthesis of natural products and the use of parasitic and fungal P450 structures as targets for drug discovery. Studies on mammalian P450s include the utilization of information about ‘drug-metabolizing’ P450s to improve drug development and also to understand the molecular bases of endocrine dysfunction.

show abstract

“…Our general approach has been described previously (Lim et al ., 2012; Han et al ., 2015). The open reading frame for CYP158A3 was isolated directly by PCR amplification from S. avermitilis cells, and a 6×His-C-terminal tag was appended using forward and reverse primers (5′CGAATCATATGACC-GAGAAA3′, 5′TCTAGACCGGAAGCTTTTAGTGATGGTGATG-GTGATGCCAGGTCACGGGCAG3′).…”

Section: Methodsmentioning

confidence: 99%

Characterization of a Biflaviolin Synthase CYP158A3 from Streptomyces avermitilis and Its Role in the Biosynthesis of Secondary Metabolites

Lim

Han

Kim

et al. 2016

Biomol Ther (Seoul)

Self Cite

View full text Add to dashboard Cite

Streptomyces avermitilis produces clinically useful drugs such as avermectins and oligomycins. Its genome contains approximately 33 cytochrome P450 genes and they seem to play important roles in the biosynthesis of many secondary metabolites. The SAV_7130 gene from S. avermitilis encodes CYP158A3. The amino acid sequence of this enzyme has high similarity with that of CYP158A2, a biflaviolin synthase from S. coelicolor A3(2). Recombinant S. avermitilis CYP158A3 was heterologously expressed and purified. It exhibited the typical P450 Soret peak at 447 nm in the reduced CO-bound form. Type I binding spectral changes were observed when CYP158A3 was titrated with myristic acid; however, no oxidative product was formed. An analog of flaviolin, 2-hydroxynaphthoquinone (2-OH NQ) displayed similar type I binding upon titration with purified CYP158A3. It underwent an enzymatic reaction forming dimerized product. A homology model of CYP158A3 was superimposed with the structure of CYP158A2, and the majority of structural elements aligned. These results suggest that CYP158A3 might be an orthologue of biflaviolin synthase, catalyzing C-C coupling reactions during pigment biosynthesis in S. avermitilis.

show abstract

Functional characterization of CYP107W1 from Streptomyces avermitilis and biosynthesis of macrolide oligomycin A

Cited by 24 publications

References 30 publications

Biochemical and Structural Characterization of MycCI, a Versatile P450 Biocatalyst from the Mycinamicin Biosynthetic Pathway

Biochemical and Structural Characterization of MycCI, a Versatile P450 Biocatalyst from the Mycinamicin Biosynthetic Pathway

Recent Structural Insights into Cytochrome P450 Function

Characterization of a Biflaviolin Synthase CYP158A3 from Streptomyces avermitilis and Its Role in the Biosynthesis of Secondary Metabolites

Contact Info

Product

Resources

About