Functional Characterization of Human Cysteinyl Leukotriene 1 Receptor Gene Structure

Abstract

The 5-lipoxygenase pathway has been strongly implicated in the pathogenesis of chronic inflammatory disorders, such as bronchial asthma and atherosclerosis. Cysteinyl leukotrienes (cysLTs), 5-lipoxygenase pathway products, are recognized now not only as important factors in asthmatic inflammation, but also as mediators of cell trafficking and innate immune responses. To study a role of cysLTs in inflammatory reactions we have characterized the gene structure of human cysteinyl leukotriene receptor type I (cysLT1R). The cysLT1R gene consists of 5 exons that are variably spliced and a single promoter region with multiple transcription start sites. Four different cysLT1R transcripts were identified. RT-PCR showed dominant and wide expression of the transcript I, containing exons 1, 4, and 5, with the strongest presence in blood leukocytes, spleen, thymus, lung, and heart. The expression of cysLT1R is functionally regulated at the transcriptional level by IL-4 through a STAT6 response element localized to the proximal cysLT1R promoter region. IL-4 stimulation increased cysLT1R mRNA (real-time PCR) and surface protein expression (flow cytometry) in a time-dependent fashion. CysLTs (LTD4 and LTC4) induced an increased production of a potent monocyte chemoattractant CCL2 (MCP-1) in IL-4-primed THP-1 cells in a dose-dependent manner. This effect was effectively inhibited by the cysLT1R-selective antagonist MK571 in a dose-dependent manner and only partially by a nonselective cysLT1R/cysLT2R inhibitor BAY-u9773, implying a cysLT1R-mediated mechanism. Thus, cysLTs signaling through cysLT1R might contribute to inflammatory reactions by cooperating with IL-4 in enhanced CCL2 production in human monocytic cells.

Leukotriene D4 induces gene expression in human monocytes through cysteinyl leukotriene type I receptor

“…We previously showed that in human PBMCs 2 alternative splice variants of CysLTR 1 can be detected. 23 Analysis of mRNA expression showed that CysLTR 1 transcript 1 is the major transcript detected in monocytes, with 20-to 40-fold higher levels than CysLTR 1 transcript 2 and CysLTR 2 . Also, functional data point to CysLTR 1 signaling as the major pathway in response to CysLTs because calcium signaling, gene expression, activation of p38 MAPK, and monocyte chemotaxis all were inhibited by the selective CysLTR 1 inhibitor MK571.…”

Regulation of Monocyte Chemoattractant Protein 1 by Cysteinyl Leukotriene D4 in Human Lung Epithelial A549 Cells

“…In this study, a T H 2 environment with IL-4 induced CysLTR1 expression and MCP-1 production in bronchial epithelial cells. Secretion of MCP-1 from IL-4 -primed A549 cells was further increased after stimulation with LTD 4 . The upregulation of CysLTR1 expression by IL-4 can be explained by a signal transducer and activator of transcription 6 element localized in its promoter region 4 that may promote the proinflammatory effects of CysLTs.…”

“…Secretion of MCP-1 from IL-4 -primed A549 cells was further increased after stimulation with LTD 4 . The upregulation of CysLTR1 expression by IL-4 can be explained by a signal transducer and activator of transcription 6 element localized in its promoter region 4 that may promote the proinflammatory effects of CysLTs. Increased production of MCP-1 in bronchial epithelial cells may promote infiltration of eosinophils, 5 which may lead to chronic inflammation in the asthmatic airway.…”

IFN-γ Induces Cysteinyl Leukotriene Receptor 2 Expression and Enhances the Responsiveness of Human Endothelial Cells to Cysteinyl Leukotrienes

“…The 5ЈRACE was performed on total RNA extracted from HUVEC, HMVEC-L, human elutriated monocytes, THP-1, and U937 cells using the Gene Racer kit (Invitrogen Life Technologies), as previously described (20). The following CysLTR2 gene-specific primers were used: GSP1, 5Ј-CCAGGAAACGCACAACACTCAGCACG and GSP2 nested, 5Ј-GAT AGGGAGATGGATGGTTGCAAGGAC.…”

“…Human CysLTR2 promoter fragments were cloned into pGL3-basic plasmid reporter vector (Promega) using the method previously described (20). A set of fragments up to 3012 bp long (numbers refer to the length of cloned promoter fragments with 3Ј end localized to position Ϫ43 in relation to 3Ј end of exon 1 as nt Ϫ1) of the identified CysLTR2 putative promoter region was amplified from human genomic DNA (Stratagene) by PCR with the following primers containing consensus sequences for KpnI and SacI restriction enzymes: p3012 F1, 5Ј-GACTAGGTCGGTACCTAC AGATTCAGAAGCAGGGAGTAGG and R1, 5Ј-GACTAGGTCGAGCT CCTATCTCTCCTGCCTTTC; p1305 F2, 5Ј-GACTAGGTCGGTACCTC CTTAGTTTCCATTTTTGGATTGTT and R1; p976 F3, 5Ј-GACTAGGT CGGTACCTTTATGGGCAGAACAAATGGAACT and R1; p339 F4, 5Ј-GACTAGGTCGGTACCTCTAAAGTGCTATGTGTGTAAGG and R1; p224 F5, 5Ј-GACTAGGTCGGTACCGGTTTCTTCTTTTTAGACATAGC FIGURE 1.…”