Functional characterization of rare FOXP2 variants in neurodevelopmental disorder

Abstract

BackgroundHeterozygous disruption of FOXP2 causes a rare form of speech and language impairment. Screens of the FOXP2 sequence in individuals with speech/language-related disorders have identified several rare protein-altering variants, but their phenotypic relevance is often unclear. FOXP2 encodes a transcription factor with a forkhead box DNA-binding domain, but little is known about the functions of protein regions outside this domain.MethodsWe performed detailed functional analyses of seven rare FOXP2 variants found in affected cases, including three which have not been previously characterized, testing intracellular localization, transcriptional regulation, dimerization, and interaction with other proteins. To shed further light on molecular functions of FOXP2, we characterized the interaction between this transcription factor and co-repressor proteins of the C-terminal binding protein (CTBP) family. Finally, we analysed the functional significance of the polyglutamine tracts in FOXP2, since tract length variations have been reported in cases of neurodevelopmental disorder.ResultsWe confirmed etiological roles of multiple FOXP2 variants. Of three variants that have been suggested to cause speech/language disorder, but never before been characterized, only one showed functional effects. For the other two, we found no effects on protein function in any assays, suggesting that they are incidental to the phenotype. We identified a CTBP-binding region within the N-terminal portion of FOXP2. This region includes two amino acid substitutions that occurred on the human lineage following the split from chimpanzees. However, we did not observe any effects of these amino acid changes on CTBP binding or other core aspects of FOXP2 function. Finally, we found that FOXP2 variants with reduced polyglutamine tracts did not exhibit altered behaviour in cellular assays, indicating that such tracts are non-essential for core aspects of FOXP2 function, and that tract variation is unlikely to be a highly penetrant cause of speech/language disorder.ConclusionsOur findings highlight the importance of functional characterization of novel rare variants in FOXP2 in assessing the contribution of such variants to speech/language disorder and provide further insights into the molecular function of the FOXP2 protein.Electronic supplementary materialThe online version of this article (doi:10.1186/s11689-016-9177-2) contains supplementary material, which is available to authorized users.

Equivalent missense variant in the FOXP2 and FOXP1 transcription factors causes distinct neurodevelopmental disorders

“…The same effect is seen with the p.R553H variant in FOXP2 (Fig. ) (Estruch et al., ). Interestingly, in our BRET assays, neither the p.R514H FOXP1 variant nor the p.R553H FOXP2 variant interacted with TBR1 (Fig.…”

“…Wild‐type (WT) FOXP1/2 , TBR1 (MIM# 604616) and CTBP1/2 (MIM# 602618; 602619) were amplified by PCR and subcloned into pLuc, pYFP, and a modified pmCherry‐C1 expression vector (Clontech, Mountain View, CA) as previously described (Deriziotis, Graham, Estruch, & Fisher, ; Deriziotis et al., ; Estruch, Graham, Chinnappa, Deriziotis, & Fisher, ). Variants were generated using the QuikChange II Site‐Directed Mutagenesis Kit (Agilent Technologies) using the following primers: FOXP1 p.R514H, sense 5′‐ACGTGGAAGAATGCAGTGCATCATAATCTTAGTCTTCAC‐3′ and antisense 5′‐GTGAAGACTAAGATTATGATGCACTGCATTCTTCCACGT‐3′; FOXP2 p.R553H, sense 5′‐CTTGGAAGAATGCAGTACATCATAATCTTAGCCTGCAC‐3′, and antisense 5′‐GTGCAGGCTAAGATTATGATGTACTGCATTCTTCCAAG‐3′.…”

Neuroimaging genetics studies of specific reading disability and developmental language disorder: A review

“…Consistent with the CDCV hypothesis, many of the identified genetic variants associated with SRD and DLD are (a) fairly common in the general population; (b) carried by only a small subset of individuals with these disorders; and (c) not clearly linked to the behavioral phenotype of the individuals who carry them. There are, however, some rare variants associated with language and reading phenotypes which have been found in more severely impaired individuals, including some of the FOXP2 variants associated with speech and language impairment (e.g., see Estruch et al, ).…”

“…Publications focused on patient populations and/or individuals with disorders other than SRD and DLD were excluded from our review. including some of the FOXP2 variants associated with speech and language impairment (e.g., see Estruch et al, 2016). Under both the CDRV and CDCV approaches, two primary methods are used for the identification of genes associated with complex neurodevelopmental disorders.…”

Pathogenic missense mutation pattern of forkhead box genes in neurodevelopmental disorders

“…FOXP1:p.R514H lost the transcriptional repression activity (Sollis et al, ; Vernes et al, ). Both variants can mislocalize and aggregate wild type FOXP1 and FOXP2 in the nucleus and cytoplasm (Estruch, Graham, Chinnappa, Deriziotis, & Fisher, ; Sollis et al, ). Another equal position in FOXG1, Arg230His, was reported to affect the affinity of FOXG1 for DNA (Takahashi et al, ).…”