Functional variation of MC1R alleles from red-haired individuals

Abstract

Red hair in humans is associated with variant alleles of the alphaMSH receptor gene, MC1R. Loss of MC1R function in other mammals results in red or yellow hair pigmentation. We show that a mouse bacterial artificial chromosome (BAC) which contains Mc1r will efficiently rescue loss of Mc1r in transgenic mice, and that overexpression of the receptor suppresses the effect of the endogenous antagonist, agouti protein. We engineered the BAC to replace the mouse coding region with the human MC1R sequence and used this in the transgenic assay. The human receptor also efficiently rescued Mc1r deficiency, and in addition, appeared to be completely resistant to the effects of agouti, suggesting agouti protein may not play a role in human pigmentary variation. Three human variant alleles account for 60% of all cases of red hair. We engineered each of these in turn into the BAC and find that they have reduced, but not completely absent, function in transgenic mice. Comparison of the phenotypes of alphaMSH-deficient mice and humans in conjunction with this data suggests that red hair may not be the null phenotype of MC1R.

Palmitoylation-dependent activation of MC1R prevents melanomagenesis

“…6a). Unlike previous transgenic MC1R RHC mice developed by Healy et al 3 using bacterial artificial chromosomes (BAC), our MC1R R151C variant offspring show a mosaic coat color that could arise as a consequence of the promoter used, integration site, or mouse strain background. Our other RHC-variants exhibited a paler coat color than WT (Fig.…”

“…The transgene was detected by genotyping mice tail DNA using the primers targeting fragment across Tyr promoter and MC1R region (~1200 bp, forward 5′- GGGCTATGTACAAACTCCAAGA′-3, reverse 5′-ACACTTAAAGCGCGTGCACCGC-′3). The expression levels of human transgene were determined as described 3 . Briefly, total RNA was collected from primary melanocytes isolated from neonatal transgenic mouse skins using RNeasy Mini Kit (Qiagen, Hilden, Germany).…”

“…Primers were used as previously described 7 to amplify both the mouse and human MC1R. A following extension was performed using primer as previously described 3 by adding ddTTP (mouse MC1R) or ddCTP (human MC1R) (SNaPshot Multiplex Kit, Thermo Fisher Scientific Inc.). Extension products were separated by capillary electrophoresis and quantified by measuring human/mouse MC1R ratio.…”

Malignant melanoma: genetics and therapeutics in the genomic era

“…Three common variants of MC1R (R151C, R160W, and D294H) have been associated with the so-called Red Hair Color (RHC) phenotype (Box et al 1997Smith et al 1998;Flanagan et al 2000;Palmer et al 2000;Bastiaens et al 2001a,b), characteristic of individuals with red hair, fair complexion, an inability to tan, and a tendency to freckle. Carrying a single RHC MC1R variant is associated with a significantly diminished ability of the epidermis to respond to damage by UV (Flanagan et al 2000;Box et al 2001;Healy et al 2001), presumably contributing to increased melanoma risk (Palmer et al 2000;Healy et al 2001). However, the observation that RHC MC1R variants are associated with increased melanoma risk even in individuals with dark/olive complexions (Palmer et al 2000;Healy et al 2001;Kennedy et al 2001) suggests that MC1R have additional pigment-independent effect(s) on melanoma risk.…”

Red hair and anesthetic requirement

“…In contrast, red hair is caused by a mutation of the melanocortin-1 receptor. [1][2][3] People with this mutation produce pheomelanin, which is yellow-red and accounts for the red hair and fair complexion consequent to defective melanocortin receptors.…”