Further dissection of QTLs for salt-induced stroke and identification of candidate genes in the stroke-prone spontaneously hypertensive rat

Abstract

We previously revealed that two major quantitative trait loci (QTLs) for stroke latency of the stroke-prone spontaneously hypertensive rat (SHRSP) under salt-loading were located on chromosome (Chr) 1 and 18. Here, we attempted further dissection of the stroke-QTLs using multiple congenic strains between SHRSP and a stroke-resistant hypertensive rat (SHR). Cox hazard model among subcongenic strains harboring a chromosomal fragment of Chr-1 QTL region showed that the most promising region was a 2.1 Mbp fragment between D1Rat177 and D1Rat97. The QTL region on Chr 18 could not be narrowed down by the analysis, which may be due to multiple QTLs in this region. Nonsynonymous sequence variations were found in four genes (Cblc, Cxcl17, Cic, and Ceacam 19) on the 2.1 Mbp fragment of Chr-1 QTL by whole-genome sequence analysis of SHRSP/Izm and SHR/Izm. Significant changes in protein structure were predicted in CBL-C and CXCL17 using I-TASSER. Comprehensive gene expression analysis in the kidney with a cDNA microarray identified three candidate genes (LOC102548695 (Zinc finger protein 45-like, Zfp45L), Ethe1, and Cxcl17). In conclusion, we successfully narrowed down the QTL region on Chr 1, and identified six candidate genes in this region.

The protective and pathogenic roles of CXCL17 in human health and disease: Potential in respiratory medicine

“…Additionally, expression of CXCL17 is co-regulated with other proangiogenic molecules as IL-8, GRO-1 and VEGF in samples from lung, breast and esophageal cancers [20]. Finally, CXCL17 is one of the most important genes mutated within specific genetic loci of stroke susceptibility in stroke-prone spontaneously hypertensive rats, a murine model of spontaneous cerebral hemorrhage suggesting a potential participation of this chemokine in the maintenance of vascular structure [38].…”

“…Angiogenic activity of CXC chemokines is dependent on the presence or absence of the ELR motif [10,37]. Although the ELR motif has not been described in CXCL17, functionally it behaves as a member of the group of angiogenic factors [20,23,38]. In fact, several human endothelial cell lines such as human microvascular endothelial cells (HMVEC), sephranose vascular endothelial cells (SPVEC) and human umbilical vascular endothelial cells (HUVEC) express higher levels of CXCL17 during proliferation or tube formation [20].…”

A 3-Mbp fragment on rat chromosome 1 affects susceptibility both to stroke and kidney injury under salt loading in the stroke-prone spontaneously hypertensive rat: a genetic approach using multiple congenic strains

“…SHRSP/Izm rats were provided by the Disease Model Cooperative Research Association (Kyoto, Japan). Subcongenic strains harboring a SHR/Izm-derived chr-1 fragment on the genetic background of SHRSP/Izm were obtained as described previously [ 3 , 4 ]. Briefly, Pr1.10 females (termed SHRSP.SHR-( D1Mgh5 - D1Got87 )/Izm, NBRP Rat No.0709) were backcrossed with a SHRSP/Izm male, and the resulting F1 rats were intercrossed to obtain pups of the F2 generation.…”

“…Previously, we identified major quantitative trait loci (QTL) for salt-induced stroke on chromosome (chr) 1 and 18 by linkage analysis [ 3 ]. In a recent study using reciprocal congenic strains for the stroke QTLs [ 4 ], we identified six candidate genes (Cbl protooncogene C, Cblc ; C-X-C motif chemokine ligand 17, Cxcl17 ; zinc finger protein 45-like, LOC102548695 , Zfp45L ; ETHE1 persulfide dioxygenase, Ethe1 ; capicua transcriptional repressor, Cic ; and carcinoembryonic antigen-related cell adhesion molecule 19, Ceacam 19 ) in a 3-Mbp fragment on chr 1 covered by a SHRSP-based congenic strain, Pr1.31. However, as the annotated molecular functions of these six genes were not directly involved in the development of stroke, it is essential to explore their functional roles in the development of stroke or to reduce the number of candidate genes further (ideally, to only one).…”

Evaluation of Pathological Association between Stroke-Related QTL and Salt-Induced Renal Injury in Stroke-Prone Spontaneously Hypertensive Rat

“…Gene expression of Col1α-1 , Tgf- β , α-Sma ( markers for fibrosis), and Kim-1 ( a marker for tubular injury) was determined in the kidney by quantitative RT-PCR as described previously [15, 16]. The primers used are as follows: α-Sma : GAGATCTCACCGACTACCTCATGA (forward), TCATTTTCAAAGTCCAGAGCGACA (reverse), Tgf- β : ATCCATGACATGAACCGACCCT (forward), GCCGTACACAGCAGTTCTTCTC (reverse), Col1α -1 : ACATGTTCAGCTTTGTGGACCTC (forward), TCAGGTTTCCACGTCTCACCA (reverse), Kim-1 : GGAGCAGCGGTCGATACAACATA (forward), TCTCCACTCGGCAACAATACAGAC (reverse).…”