Fusobacterium necrophorum infections in animals: Pathogenesis and pathogenic mechanisms

Nagaraja, T. G.; Narayanan, Sanjeev; Stewart, George C.; Chengappa, M. M.

doi:10.1016/j.anaerobe.2005.01.007

Cited by 159 publications

(131 citation statements)

References 61 publications

Supporting

Mentioning

123

Contrasting

Unclassified

Order By: Relevance

“…It is an opportunistic pathogen causing diseases in dairy and beef cattle and swine (Jost and Billington, 2005), and foot diseases in domestic and wild animals (Davies et al, 1999;Lavín et al, 2004). This bacterium has been isolated from necrotic disease caused by F. necrophorum (Chrino-Trejo et al, 2003;Jones et al, 2004;Nagaraja et al, 2005); however, there is no clear evidence of its association with footrot in sheep. A. pluranimalium is a new species of Arcanobacterium recently described (Lawson et al, 2001).…”

Section: Comparison Of the Microbial Communities And Taxonomic Classimentioning

confidence: 99%

See 1 more Smart Citation

Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome

et al. 2011

View full text Add to dashboard Cite

We report the first study of the bacterial microbiome of ovine interdigital skin based on 16S rRNA by pyrosequencing and conventional cloning with Sanger-sequencing. Three flocks were selected, one a flock with no signs of footrot or interdigital dermatitis, a second flock with interdigital dermatitis alone and a third flock with both interdigital dermatitis and footrot. The sheep were classified as having either healthy interdigital skin (H) and interdigital dermatitis (ID) or virulent footrot (VFR). The ovine interdigital skin bacterial community varied significantly by flock and clinical condition. The diversity and richness of operational taxonomic units was greater in tissue from sheep with ID than H or VFR-affected sheep. Actinobacteria, Bacteriodetes, Firmicutes and Proteobacteria were the most abundant phyla comprising 25 genera. Peptostreptococcus, Corynebacterium and Staphylococcus were associated with H, ID and VFR, respectively. Sequences of Dichelobacter nodosus, the causal agent of ovine footrot, were not amplified because of mismatches in the 16S rRNA universal forward primer (27F). A specific real-time PCR assay was used to demonstrate the presence of D. nodosus, which was detected in all samples including the flock with no signs of ID or VFR. Sheep with ID had significantly higher numbers of D. nodosus (10 4 -10 9 cells per g tissue) than those with H or VFR feet.

show abstract

Section: Comparison Of the Microbial Communities And Taxonomic Classimentioning

confidence: 99%

“…F. necrophorum is a normal inhabitant of the alimentary tract of animals (Langworth, 1977) and is detected in faecal (Tadepalli et al, 2009) and oral (Zaura et al, 2009) material. It is also associated with abscesses in sheep feet (Nagaraja et al, 2005;Zhou et al, 2009).…”

Section: Comparison Of the Microbial Communities And Taxonomic Classimentioning

confidence: 99%

Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome

et al. 2011

View full text Add to dashboard Cite

show abstract

“…Trueperella pyogenes is the second most frequently isolated pathogen in liver abscesses (Tan et al, 1996). The frequent association of T. pyogenes with F. necrophorum, not only in liver abscesses, but also in foot rot and abscesses in cattle (Nagaraja et al, 2005) and metritis in dairy cows (Bicalho et al, 2012), is because of the nutritional and pathogenic synergy between the 2 species (Tadepalli et al, 2009). Generally, the occurrence of T. pyogenes is around 2% to 20% of liver abscesses (Nagaraja et al, 1996a).…”

Section: Trueperella Pyogenesmentioning

confidence: 99%

“…funduliforme (Hall et al, 1997;Tadepalli et al, 2008). The difference in virulence correlates with the difference in virulence factors between the 2 subspecies, with leukotoxin being the major virulence factor involved in the infection (Emery and Vaughan, 1986;Tan et al, 1996;Narayanan et al, 2003;Nagaraja et al, 2005). Leukotoxin is an exotoxin, composed of protein that is cytotoxic to neutrophils, macrophages, hepatocytes, and possibly to ruminal epithelial cells (Narayanan et al, 2002).…”

Section: Fusobacterium Necrophorummentioning

confidence: 99%

Liver abscesses in cattle: A review of incidence in Holsteins and of bacteriology and vaccine approaches to control in feedlot cattle12

Amachawadi

Nagaraja

2016

Journal of Animal Science

114

View full text Add to dashboard Cite

2 Adapted from Rezac et al. (2014b). Data collected at commercial packing plants in Kansas and Texas. 3 Adapted from Rezac et al. (2014a). Data collected at a commercial packing plant in the Great Lakes region.4 Normal = Liver free from abscesses; A-= Liver with 1 to 2 small abscesses; A = Liver with 2 to 4 large abscesses or multiple small abscesses; A+ = Liver with multiple large abscesses, abscesses adhered to diaphragm, abdominal organs or both, or open or ruptured abscesses.5 Numbers in parentheses are percentage of total abscesses.

show abstract

“…funduliforme, is one of the most common anaerobic bacteria isolated from abscesses, respiratory tract infections, and other necrotizing infections in domestic livestock, wild mammals, and human beings. 6,15,23 While the role of F. necrophorum in hepatic abscessation, necrotizing laryngitis, and foot rot in cattle, small ruminants, and camelids is well recognized, the association with severe respiratory tract infections in deer is infrequently recognized in the literature and the pathogenesis is poorly characterized. 3,21 Although less extensively investigated, Fusobacterium varium has been associated with ulcerative colitis, colonic neoplasia, decubitus ulcers, and respiratory tract infections in human beings, and with suppurative or ulcerative lesions of the gastrointestinal tract or oral cavity in animals.…”

Section: Introductionmentioning

confidence: 99%

Characterization of Fusobacterium isolates from the respiratory tract of white-tailed deer (Odocoileus virginianus)

et al. 2014

View full text Add to dashboard Cite

Abstract.A total of 23 clinical isolates of Fusobacterium spp. were recovered at necropsy over a 2-year period from the respiratory tract of white-tailed deer (Odocoileus virginianus). Isolates were identified as Fusobacterium varium (18/23), Fusobacterium necrophorum subsp. funduliforme (3/23), and Fusobacterium necrophorum subsp. necrophorum (2/23). Using polymerase chain reaction-based detection of virulence genes, all F. necrophorum isolates were positive for the promoter region of the leukotoxin operon and the hemagglutinin-related protein gene, while all F. varium isolates were negative. The presence of the leukotoxin gene in F. necrophorum isolates and the absence of this gene in F. varium isolates were confirmed by Southern hybridization using 2 separate probes. Toxicity to bovine polymorphonuclear leukocytes was observed with all F. necrophorum isolates, but was not observed in any F. varium isolates. Susceptibility to antimicrobials was markedly different for F. varium as compared to F. necrophorum. In summary, no evidence of leukotoxin production was detected in any of the 23 F. varium isolates used in the current study. The data suggests that F. varium, the most common species isolated, may be a significant pathogen in deer with a different virulence mechanism than F. necrophorum. Tissue samples were cultured on prereduced Brucella agar plates b supplemented with 5% sheep blood, hemin (5 mg/l), and vitamin K (10 mg/l), and then incubated at 37°C for 48 hr in an anaerobic chamber. The 3-way antibiotic disk diffusion susceptibility test and nitrate test were conducted on Brucella agar plates with vancomycin, kanamycin, colistin, and nitrate disks.c Nitrate-negative isolates showing resistance to vancomycin and susceptibility to kanamycin and colistin were presumptively determined to be Fusobacterium sp.9 Following presumptive identification, the indole test was performed by placing 1 drop of indole reagent c onto an antibiotic disk. A pre-reduced McClung-Toabe egg yolk agar plate b was inoculated and incubated anaerobically at 37°C for 48-72 hr to determine lipase activity. Bile tolerance was determined by plating colonies onto pre-reduced Bacteroides fragilis isolation agar plates b containing 20% bile and incubating anaerobically at 37°C for 48-72 hr. Overnight cultures in prereduced anaerobically sterilized brain-heart infusion broth were observed for growth and sedimentation. All isolates were analyzed with commercial kits d,e according to the manufacturers' instructions. DNA extraction and 16S ribosomal DNA sequencingChromosomal DNA was extracted from all isolates. Briefly, cultures were grown anaerobically on pre-reduced blood agar plates at 37°C for 48-72 hr. The DNA was isolated using a commercial kit f according to the manufacturer's instructions. The extracts were stored at −20°C. Universal primers (p515FPL forward GCGGATCCTCTAGACT GCAGTGCCAGCAGCCGCGGTAA, and p13B reverse CGGGATCCCAGGCCCGGGAACGTATTCAC) were used to amplify a region of the 16S ribosomal RNA gene by polymerase chain reaction (P...

show abstract

Fusobacterium necrophorum infections in animals: Pathogenesis and pathogenic mechanisms

Cited by 159 publications

References 61 publications

Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome

Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome

Liver abscesses in cattle: A review of incidence in Holsteins and of bacteriology and vaccine approaches to control in feedlot cattle12

Characterization of Fusobacterium isolates from the respiratory tract of white-tailed deer (Odocoileus virginianus)

Contact Info

Product

Resources

About