G 12/13 inhibition enhances the anticancer effect of bortezomib through PSMB5 downregulation

Abstract

Bortezomib is a proteasome inhibitor approved for anticancer therapy. However, variable sensitivity of tumor cells exists in this therapy probably due to differences in the expression of proteasome subunits. G(alpha)(12/13) serves modulators or signal transducers in diverse pathways. This study investigated whether cancer cells display differential sensitivity to bortezomib with reference to G(alpha)(12/13) expression, and if so, whether G(alpha)(12/13) affects the expression of proteasome subunits and their activities. Bortezomib treatment exhibited greater sensitivities in Huh7 and SNU886 cells (epithelial type) than SK-Hep1 and SNU449 cells (mesenchymal type) that exhibited higher levels of G(alpha)(12/13). Overexpression of an active mutant of G(alpha)(12) (Galpha(12)QL) or G(alpha)(13) (G(alpha)(13)QL) diminished the ability of bortezomib to induce cytotoxicity in Huh7 cells. Moreover, transfection with the minigene that disturbs G protein-coupled receptor-G protein coupling (CT12 or CT13) increased it in SK-Hep1 cells. Consistently, MiaPaCa2 cells transfected with CT12 or CT13 exhibited a greater sensitivity to bortezomib. Evidence of G(alpha)(12/13)'s antagonism on the anticancer effect of bortezomib was verified in the reversal by G(alpha)(12)QL or G(alpha)(13)QL of the minigenes' enhancement of cytotoxity. Real-time polymerase chain reaction assay enabled us to identify PSMB5, multicatalytic endopeptidase complex-like-1, and proteasome activator subunit-1 repression by CT12 or CT13. Furthermore, G(alpha)(12/13) inhibition enhanced the ability of bortezomib to repress PSMB5, as shown by immunoblotting and proteasome activity assay. Moreover, this inhibitory effect on PSMB5 was attenuated by G(alpha)G(alpha)(12)QL or G(alpha)(13)QL. In conclusion, the inhibition of G(alpha)(12/13) activities may enhance the anticancer effect of bortezomib through PSMB5 repression, providing insight into the G(alpha)(12/13) pathway for the regulation of proteasomal activity.

Gα12 gep oncogene deregulation of p53-responsive microRNAs promotes epithelial–mesenchymal transition of hepatocellular carcinoma

“…41 Cell culture Huh7, HepG2, SK-Hep1 and SNU449 cells were cultured as described previously. 14,42 Stable transfection of the active mutant of Gα 12 (Gα 12 Q229L, Gα 12 QL) was carried out previously. 14 To establish Gα 12 -depleted SK-Hep1 cells, oligonucleotides for the generation of shRNA were designed as follows: control (luciferase) 5′-GGATCCGCGGTTGCCAAGAGGTT CCATTTCAAGAGAATGGAACCTCTTGGCAACCGCTTTTTTGGAAAGCTT-3′; and Gα 12 , 5′-GGATCCGCGACACCATCTTCGACAACATTTCAAGAGA ATGTTGTCGA AGATGGTGTCGCTTTTTTGGAAAGCTT-3′.…”

“…Gα 12 miRNome and integrative analysis of miRNA and mRNA changes To understand the effect of Gα 12 overexpression on the pathophyiology of HCC and establish a cellular model system in vitro, we used an HCC cell line stably transfected with a constitutively active (CA) Q229L mutant of Gα 12 (Gα 12 QL) as a tool. 13,14 Of the widely used liver tumor cell lines, we first used Huh7 because it has low Gα 12 expression, and subjected wild-type (WT)-Huh7 and Gα 12 QL-Huh7 to the miRNA microarray assays ( Figure 2a). Volcano plot shows the relationship of changes in miRNA expression between the two groups with significance (Supplementary Figure S1a).…”

Proteasome expression and activity in cancer and cancer stem cells

“…In this respect, another study reported that repression of PSMB5, PSMB10, and PA28α sub-units sensitized hepatocellular carcinoma cells to bortezomib. 97 STAT3 is a transcription factor activated down-stream of several receptor tyrosine kinases, including EGFR, and cytokine receptors (Figure 7). It is activated in several cancer cell types and has been shown to up-regulate several β sub-units of the 20S proteasome.…”

The resistance mechanisms of proteasome inhibitor bortezomib

“…Therefore, over-expression of the PSMB5 gene in response to drug stress, contributing to the increased chymotrypsinlike activity, is an important mechanism of acquired bortezomib resistance. Study of Yang YM et al demonstrated that the PSMB5 downregulation by Ga12/13 inhibition enhances the anticancer effect of bortezomib, which may be of use to improve bortezomib therapy and reduce bortezomib resistance [31]. Former study by Kraus et al showed that the proteasomal activity profile varies in primary leukemia cells, and that the pattern of proteasomal subunit activity influences the sensitivity of hematologic malignancies toward bortezomib [32].…”