G4Hunter web application: a web server for G-quadruplex prediction

Brázda, Václav; Kolomazník, Jan; Lýsek, Jiří; Bartas, Martin; Fojta, Miroslav; Šťastný, Jiří; Mergny, Jean‐Louis

doi:10.1093/bioinformatics/btz087

Cited by 163 publications

(138 citation statements)

References 24 publications

Supporting

Mentioning

135

Contrasting

Order By: Relevance

“…To elucidate the influence of a G4 on p53α transcriptional activity, we exploited yeast isogenic reporters. We used the following G-rich DNA sequence GGGGCGGGGGACGGGGGAGGGG, which is very highly prone to form a G4, based on the propensity score given by the G4Hunter tool [33,34] (G4Hunter score 3.182), which is even higher than the sequence from the c-Myc promoter region (G4Hunter score 2.941) where the presence of the G4 structure has been evaluated both in vitro and in vivo [35,36]. We confirmed the propensity of this sequence to form G4 by CD spectroscopy (Figure 1).…”

Section: Construction Of Isogenic Yeast Strainsmentioning

confidence: 99%

The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms

Porubiaková

Bohálová

Inga

et al. 2019

IJMS

Self Cite

View full text Add to dashboard Cite

p53 is one of the most studied tumor suppressor proteins that plays an important role in basic biological processes including cell cycle, DNA damage response, apoptosis, and senescence. The human TP53 gene contains alternative promoters that produce N-terminally truncated proteins and can produce several isoforms due to alternative splicing. p53 function is realized by binding to a specific DNA response element (RE), resulting in the transactivation of target genes. Here, we evaluated the influence of quadruplex DNA structure on the transactivation potential of full-length and N-terminal truncated p53α isoforms in a panel of S. cerevisiae luciferase reporter strains. Our results show that a G-quadruplex prone sequence is not sufficient for transcription activation by p53α isoforms, but the presence of this feature in proximity to a p53 RE leads to a significant reduction of transcriptional activity and changes the dynamics between co-expressed p53α isoforms.

show abstract

Section: Construction Of Isogenic Yeast Strainsmentioning

confidence: 99%

The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms

Porubiaková

Bohálová

Inga

et al. 2019

IJMS

Self Cite

View full text Add to dashboard Cite

show abstract

“…Several bioinformatics tools have been developed to identify potential quadruplex sequences in genomes, such as QGRS Mapper [68] and G4Hunter [69]. In another example, the ProQuad database developed simple rules for G-quadruplex forming patterns and used them to assess the occurrence of repeating G-tracts and their association with different genomic regions.…”

Section: Biochemical and Cellular Impacts Of Simple Repeat Sequencesmentioning

confidence: 99%

Structures and stability of simple DNA repeats from bacteria

Brázda

Fojta

Bowater

2020

Biochemical Journal

Self Cite

View full text Add to dashboard Cite

DNA is a fundamentally important molecule for all cellular organisms due to its biological role as the store of hereditary, genetic information. On the one hand, genomic DNA is very stable, both in chemical and biological contexts, and this assists its genetic functions. On the other hand, it is also a dynamic molecule, and constant changes in its structure and sequence drive many biological processes, including adaptation and evolution of organisms. DNA genomes contain significant amounts of repetitive sequences, which have divergent functions in the complex processes that involve DNA, including replication, recombination, repair, and transcription. Through their involvement in these processes, repetitive DNA sequences influence the genetic instability and evolution of DNA molecules and they are located non-randomly in all genomes. Mechanisms that influence such genetic instability have been studied in many organisms, including within human genomes where they are linked to various human diseases. Here, we review our understanding of short, simple DNA repeats across a diverse range of bacteria, comparing the prevalence of repetitive DNA sequences in different genomes. We describe the range of DNA structures that have been observed in such repeats, focusing on their propensity to form local, non-B-DNA structures. Finally, we discuss the biological significance of such unusual DNA structures and relate this to studies where the impacts of DNA metabolism on genetic stability are linked to human diseases. Overall, we show that simple DNA repeats in bacteria serve as excellent and tractable experimental models for biochemical studies of their cellular functions and influences.

show abstract

“…Guanine-enriched sequences in other eukaryotes have been shown to adopt G-quadruplex (G4) stable structures and may play potential roles in the regulation of DNA replication, transcription and translation (Falabella et al 2019). Using G4Hunter (Brázda et al 2019),…”

Section: Evolutionary Relationships Within Bigyra and Stramenopilementioning

confidence: 99%

First genome ofLabyrinthula, an opportunistic seagrass pathogen, reveals novel insight into marine protist phylogeny, ecology and CAZyme cell-wall degradation

Tan

Loke

Croft

et al. 2020

Preprint

View full text Add to dashboard Cite

Labyrinthula spp. are saprobic, marine protists that also act as opportunistic pathogens and are the causative agents of seagrass wasting disease (SWD). Despite the threat of local- and large-scale SWD outbreaks, there are currently gaps in our understanding of the drivers of SWD, particularly surrounding Labyrinthula virulence and ecology. Given these uncertainties, we investigated Labyrinthula from a novel genomic perspective by presenting the first draft genome and predicted proteome of a pathogenic isolate of Labyrinthula SR_Ha_C, generated from a hybrid assembly of Nanopore and Illumina sequences. Phylogenetic and cross-phyla comparisons revealed insights into the evolutionary history of Stramenopiles. Genome annotation showed evidence of glideosome-type machinery and an apicoplast protein typically found in protist pathogens and parasites. Proteins involved in Labyrinthula’s actin-myosin mode of transport, as well as carbohydrate degradation were also prevalent. Further, CAZyme functional predictions revealed a repertoire of enzymes involved in breakdown of cell-wall and carbohydrate storage compounds common to seagrasses. The relatively low number of CAZymes annotated from the genome of Labyrinthula SR_Ha_C compared to other Labyrinthulea species may reflect the conservative annotation parameters, a specialised substrate affinity and the scarcity of characterised protist enzymes. Inherently, there is high probability for finding both unique and novel enzymes from Labyrinthula spp. This study provides resources for further exploration of Labyrinthula ecology and evolution, and will hopefully be the catalyst for new hypothesis-driven SWD research revealing more details of molecular interactions between Labyrinthula species and its host substrate.

show abstract

G4Hunter web application: a web server for G-quadruplex prediction

Cited by 163 publications

References 24 publications

The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms

The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms

Structures and stability of simple DNA repeats from bacteria

First genome ofLabyrinthula, an opportunistic seagrass pathogen, reveals novel insight into marine protist phylogeny, ecology and CAZyme cell-wall degradation

Contact Info

Product

Resources

About