G9A promotes tumor cell growth and invasion by silencing CASP1 in non-small-cell lung cancer cells

Abstract

Non-small-cell lung cancer (NSCLC) is one of the leading causes of cancer-related death worldwide. Although epigenetic deregulation is known to be important for tumor progression, the molecular mechanisms in NSCLC remain unclear. Here, we found that G9A (known as EHMT2), a histone methyltransferase responsible for mono- or di-methylation of histone 3 (H3) lysine 9 (K9), is significantly upregulated in NSCLC. Knocking down G9A or pharmacological inhibition of its activity suppressed tumor cell growth, colony formation, invasion and migration. Furthermore, G9A exerts these functions by repressing CASP1 expression. Knocking down CASP1 in G9A-deficient cell restored capacities of tumor cell invasion and migration. Mechanistically, G9A silences the CASP1 promoter activity by increasing H3K9me2 around its promoter. Finally, high expression of G9A or low expression of CASP1 is correlated with poor overall survival in lung adenocarcinoma. Overall, our study uncovers a novel mechanism of G9A promoting tumor cell growth and invasion by silencing CASP1, and implies that G9A may serve as a therapeutic target in treating NSCLC.

Integrative Analysis of Proteome and Ubiquitylome Reveals Unique Features of Lysosomal and Endocytic Pathways in Gefitinib‐Resistant Non‐Small Cell Lung Cancer Cells

“…Total RNA extraction from cells and real‐time RT‐PCR were performed as previously described . The PCR primers used were as follows: HMGA2 forward, 5ʹ‐ GCCACCCACTACTCTGTCCT‐3ʹ; HMGA2 reverse, 5ʹ‐TTGAGATTGAAAGTGCCTTGG‐3ʹ; ALOX5 forward, 5ʹ‐GATTGTCCCCATTGCCATCC‐3ʹ; ALOX5 reverse, 5ʹ‐AGAAGGTGGGTGATGGTCTG‐3ʹ; GAPDH forward, 5ʹ‐GAGTCAACGGATTTGGTCGT‐3ʹ; and GAPDH reverse, 5ʹ‐ TTGATTTTGGAGGGATCTCG‐3ʹ.…”

“…Western blotting was performed as previously described . In some experiments, cells were treated with 20 μg mL −1 cycloheximide (CHX) (Sigma, #C7698) for 0, 2, 4, and 8 h before harvesting.…”

“…Colony formation assays were performed as previously described . The assays were performed in triplicate.…”

G9a methyltransferase governs cell identity in the lung and is required for KRAS G12D tumor development and propagation

“…Given the association of G9a expression and poor prognosis in LUAD (Chen et al, 2010;Huang et al, 2017), we sought to examine the expression and function of G9a in primary murine KrasG12D;p53 -/-(KP) tumors. Previous work established that KP tumor selfrenewal was dependent on a TPC subset.…”

“…In many biological contexts, cellular self-renewal and lineage fate commitment is controlled by epigenetic mechanisms, such as chromatin remodeling (Easwaran et al, 2014;Hemberger et al, 2009;Widschwendter et al, 2007). Recent work identified expression of the G9a lysine methyltransferase (EHMT2) as a poor prognostic factor in LUAD (Chen et al, 2010;Huang et al, 2017). Interestingly, G9a activity has been implicated in the regulation of cell identity during development primarily through its epigenetic histone methyltransferase activity (Chen et al, 2012;Epsztejn-Litman et al, 2008).…”