Gap Junction Channel Protein Innexin 2 Is Essential for Epithelial Morphogenesis in theDrosophilaEmbryo

Abstract

Direct communication of neighboring cells by gap junction channels is essential for the development of tissues and organs in the body. Whereas vertebrate gap junctions are composed of members of the connexin family of transmembrane proteins, in invertebrates gap junctions consist of Innexin channel proteins. Innexins display very low sequence homology to connexins. In addition, very little is known about their cellular role during developmental processes. In this report, we examined the function and the distribution of Drosophila Innexin 2 protein in embryonic epithelia. Both loss-of-function and gain-of-function innexin 2 mutants display severe developmental defects due to cell death and a failure of proper epithelial morphogenesis. Furthermore, immunohistochemical analyses using antibodies against the Innexins 1 and 2 indicate that the distribution of Innexin gap junction proteins to specific membrane domains is regulated by tissue specific factors. Finally, biochemical interaction studies together with genetic loss- and gain-of-function experiments provide evidence that Innexin 2 interacts with core proteins of adherens and septate junctions. This is the first study, to our knowledge, of cellular distribution and protein-protein interactions of an Innexin gap junctional channel protein in the developing epithelia of Drosophila.

DE-Cadherin, a Core Component of the Adherens Junction Complex Modifies Subcellular Localization of theDrosophilaGap Junction Protein Innexin2

“…innexin2-GFP cDNA was derived from pUAST-innexin2-GFP, which had been already used for the generation of transgenic flies (Bauer et al 2004). innexin2-Myc was generated by PCR reaction from LD11658 containing the entire innexin2 cDNA using specific innexin2 primer pairs (innexin2 start-primer: 5 -GGAATTCCAAAATGTTTGATGTCT TTGGGT -3 ; innexin2 stop-primer containing the Myc-tag, which is printed in bold letters: 5 -CGCTCGAGCG GTTACAGATCCTCTTCAGAGATGAGTTTC TGCTCGGCGTCGAAGGGCCGCTTG-3 ).…”

“…It has been shown that innexin1 (ogre) and innexin8 (shakingB) are involved in the physiology of the giant fibre and the adult visual systems (Watanabe and Kankel 1990;Curtin et al 2002;Krishnan et al 1993;Phelan et al 1996Phelan et al , 2005Shimohigashi and Meinertzhagen 1998;Zhang et al 1999;Jacobs et al 2000); innexin4 (zero population growth) controls germ cell differentiation (Tazuke et al 2002;Gilboa et al 2003) and we have recently shown that during foregut morphogenesis, innexin2 is a Wingless/WNT target gene that coordinates epithelial morphogenesis . Mutants for innexin2 (kropf), which lack both their maternal and zygotic innexin2 contributions fail to develop any epithelial tissues, and overexpression of innexin2 in the epidermis results in multilayering and irregular cell shapes suggesting that innexin2 is a key factor to control epithelial organization during morphogenesis of tissues and organs in the body (Bauer et al 2004). …”

“…Cadherins are required to maintain stable adhesion between epithelial cells (Larue et al 1994;Riethmacher et al 1995;Tepass et al 1996;Uemura et al 1996) but can also be used by migrating cells to adhere to a cellular substratum (Letourneau et al 1990;Barami et al 1994;Hazan et al 2000;Li et al 2001). In mutants for both zygotic armadillo and DE-cadherin, innexin2 localization is altered and in kropf mutants, components of adherens junctions are mislocalized (Bauer et al 2004). Further evidence for a more direct interaction between innexin2 and adherens junction proteins was provided by yeast two hybrid analysis and coimmunoprecipitation experiments using embryonic extracts, which showed that innexin2 interacts via its cytoplasmic loop domain with the C-terminus of DE-cadherin (Bauer et al 2004).…”

“…In mutants for both zygotic armadillo and DE-cadherin, innexin2 localization is altered and in kropf mutants, components of adherens junctions are mislocalized (Bauer et al 2004). Further evidence for a more direct interaction between innexin2 and adherens junction proteins was provided by yeast two hybrid analysis and coimmunoprecipitation experiments using embryonic extracts, which showed that innexin2 interacts via its cytoplasmic loop domain with the C-terminus of DE-cadherin (Bauer et al 2004). These data suggest that the biogenesis of innexin2-containing gap junctions and of adherens junctions may be linked via the interaction of innexin2 and DE-cadherin/Armadillo.…”

Immunocytochemical study of gap junction-related protein, innexin 2, in Periplaneta americana (Blattodea: Blattidae)

“…A similar protein family found in fruit flies and nematodes was named innexin (INvertebrate conEXIN) (Phelan et al, 1998a). Some innexin mutants of fruit flies and nematodes are known to show lethal failure during morphogenesis (Starich et al, 2003;Bauer et al, 2004).…”