Gastric ulcer induced changes in substance P and Nk1, Nk2, Nk3 receptors expression in different stomach localizations with regard to intrinsic neuronal system

Załęcki, Michał

doi:10.1007/s00418-018-1715-4

Cited by 18 publications

(15 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Namely, VIP is one of the key neuronal substances inhibiting gastrointestinal muscles contraction [22,31]. A similar relaxant influence on the gastric muscles is shown by GAL [46] and SP, whose the exact impact on the smooth muscular fibers clearly depends on the types of stimulated receptors [41]. The impact of CART on the gastrointestinal muscles is less known, but the previous investigations have reported that this substance also plays a role in the regulation of the smooth muscles contraction [47].…”

Section: Discussionmentioning

confidence: 87%

“…Alterations in the number of nervous structures immunopositive to the individual factors were noted in the present study both in the myenteric and submucous gastric intramural ganglia, as well as in the intramuscular and intramucosal layers. This fact clearly indicates that BPA in the stomach may also act (like in the intestine) both on the motility and the mucosal activity, because it is public known that the vast number of neurons in the muscular ganglia are involved in the processes connected to gastric motility, and structures placed in the submucous ganglia mainly participate in the regulation of intestinal secretion [ 41 ].…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Bisphenol A (BPA) Affects the Enteric Nervous System in the Porcine Stomach

Makowska

Gonkowski

2020

Animals

View full text Add to dashboard Cite

Bisphenol A (BPA) is widely utilized in plastic production process all over the world. Previous studies have shown that BPA, with its similarity to estrogen, may negatively affect living organisms. It is acknowledged that BPA distorts the activity of multiple internal systems, including the nervous, reproductive, urinary, and endocrine systems. BPA also affects the gastrointestinal tract and enteric nervous system (ENS), which is placed throughout the wall from the esophagus to the rectum. Contrary to the intestine, the influence of BPA on the ENS in the stomach is still little known. This study, performed using the double immunofluorescence method, has revealed that BPA affects the number of nervous structures in the porcine gastric wall immunoreactive to vesicular acetylcholine transporter (VAChT, a marker of cholinergic neurons), substance P (SP), vasoactive intestinal polypeptide (VIP), galanin (GAL) and cocaine- and amphetamine-regulated transcript peptide (CART). The character and severity of noted alterations depended on the part of the ENS, the BPA dose, and the type of neuronal substance. Administration of BPA resulted in an increase in the number of nervous structures containing SP, GAL, and/or CART, and a decrease in the number of cholinergic neurons in all parts of the gastric wall. The number of VIP-positive nervous structures increased in the enteric myenteric ganglia, along with the muscular and mucosal layers, whilst it decreased in the submucous ganglia. The exact mechanism of noted changes was not absolutely obvious, but they were probably related to the neuroprotective and adaptive processes constituting the response to the impact of BPA.

show abstract

Section: Discussionmentioning

confidence: 87%

Section: Discussionmentioning

confidence: 99%

Bisphenol A (BPA) Affects the Enteric Nervous System in the Porcine Stomach

Makowska

Gonkowski

2020

Animals

View full text Add to dashboard Cite

show abstract

“…Moreover, several other neuropeptides of substance P, opioids, oxytocin, and prolactin are released during stress and depression, which induces gastric mucosal hypoperfusion and gastric hypomotility 21 . Conversely, peptic ulcer disease increases the expression of neuropeptides of substance P and its receptors, thereby elevating the risk of depression 22 . In addition, peptic ulcer disease was related to immune dysfunction characterized by the downregulation of regulatory T cells and T helper cell functions 23,24 .…”

Section: Discussionmentioning

confidence: 99%

Reciprocal association between depression and peptic ulcers: Two longitudinal follow-up studies using a national sample cohort

Kim

Min

et al. 2020

Sci Rep

View full text Add to dashboard Cite

this study was aimed to explore the bidirectional association between depression and peptic ulcers. the ≥20-year-old participants of the Korean National Health Insurance Service-National Sample Cohort from 2002 to 2013 were included in the study. In study I, 30,306 depression patients were 1:4 matched with 121,224 control I participants. In study II, 127,590 peptic ulcer patients were 1:1 matched with 127,590 control II participants. The stratified Cox-proportional hazards models were used to analyse the hazard ratio (HR) of depression for peptic ulcers (study I) and of peptic ulcers for depression (study II). A total of 8.9% (2,703/ 30,306) of depression patients and 7.3% (8,896/ 121,224) of patients in the control I group had peptic ulcers (P < 0.001). The depression group had an adjusted HR for peptic ulcers that was 1.14-fold higher than that of the control I group (95% confidence interval [95% CI] = 1.09-1.19, p < 0.001). A total of 6.4% (8,144/ 127,590) of peptic ulcer patients and 3.5% (4,515/127,590) of patients in the control II group had depression (P < 0.001). The peptic ulcer group had an adjusted HR for depression that was 1.68-fold higher than that of the control II group (95% CI = 1.62-1.74, P < 0.001). Depression and peptic ulcers exhibited a bidirectional relationship. Depression is a prevalent psychological disease worldwide. A meta-analysis reported an approximately 27.0% prevalence of depressive symptoms in 83 cross-sectional studies (95% confidence intervals [95% CIs] = 24.0-29.0) 1. In Korea, about 6.7% of all age population suffered from depression (95% CI = 5.7-7.6) 2. Depression increases the risk of several physical illnesses, such as cardiovascular disease, stroke, and diabetes 3. The disturbances of metabolism, immune-inflammatory responses, autonomic regulation, and hypothalamic-pituitary-adrenal-axis in depression patients were suggested to be linked with the elevated risk of chronic diseases 3. In line with this idea, depression was reported to increase the risk of a number of gastrointestinal diseases 4,5. Several prior studies suggested a relationship between depression or psychological stress and gastrointestinal diseases 4,5. For instance, reflux oesophagitis was related to stress (odds ratio = 1.94, 95% CI = 1.25-3.02) 4. Peptic ulcer disease is defined as a submucosal injury in the digestive tract, mainly in the stomach and proximal duodenum 6. The prevalence of peptic ulcer disease is approximately 5-10%, with a decreasing tendency worldwide due to a attenuation of Helicobacter pylori infection and anti-acid medications 7,8. In Korea, approximately 5.6% of the adult population has peptic ulcer disease 9. In addition to H. pylori infection and the chronic nonsteroidal anti-inflammatory drug medications, the possible pathophysiological causes of peptic ulcer disease include the hypersecretion of acidic contents, dietary factors, and stress 6. Peptic ulcers have been associated with psychological stress, schizophrenia and anxiety 10-12. Peptic ulcer patients showed higher odds f...

show abstract

“…Primers for porcine CART (Forward: TATGTGTGACGCAGGAGAGC; Reverse: AAG-GAATTGCAGGAGGTTCC) were described by Li et al [52] and validated with Primer-BLAST online software (http://ncbi.nlm.nih.gov). Previous experiment [16] had indicated GAPDH as a relevant and reliable housekeeping gene for the study (with stably expressed values for all the animals), and previously designed primers (Forward: TTCCACCCACG-GCAAGTT; Reverse: GGCCTTTCCATTGATGACAAG) were used in the study.…”

Section: Discussionmentioning

confidence: 99%

Cocaine and Amphetamine Regulated Transcript (CART) Expression Changes in the Stomach Wall Affected by Experimentally Induced Gastric Ulcerations

Załęcki

Plywacz

Antushevich

et al. 2021

IJMS

Self Cite

View full text Add to dashboard Cite

Cocaine- and amphetamine-regulated transcript (CART) is a peptide suggested to play a role in gastrointestinal tract tissue reaction to pathology. Gastric ulceration is a common disorder affecting huge number of people, and additionally, it contributes to the loss of pig livestock production. Importantly, ulceration as a focal disruption affecting deeper layers of the stomach wall differs from other gastrointestinal pathologies and should be studied individually. The pig’s gastrointestinal tract, due to its many similarities to the human counterpart, provides a valuable experimental model for studying digestive system pathologies. To date, the role of CART in gastric ulceration and the expression of the gene encoding CART in porcine gastrointestinal tube are completely unknown. Therefore, we aimed to verify the changes in the CART expression by Q-PCR (gene encoding CART in the tissue) and double immunofluorescence staining combined with confocal microscopy (CART immunofluorescence in enteric nervous system) in the porcine stomach tissues adjacent to gastric ulcerations. Surprisingly, we found that gastric ulcer caused a significant decrease in the expression of CART-encoding gene and huge reduction in the percentage of CART-immunofluorescent myenteric perikarya and neuronal fibers located within the circular muscle layer. Our results indicate a unique CART-dependent gastric response to ulcer disease.

show abstract

Gastric ulcer induced changes in substance P and Nk1, Nk2, Nk3 receptors expression in different stomach localizations with regard to intrinsic neuronal system

Cited by 18 publications

References 70 publications

Bisphenol A (BPA) Affects the Enteric Nervous System in the Porcine Stomach

Bisphenol A (BPA) Affects the Enteric Nervous System in the Porcine Stomach

Reciprocal association between depression and peptic ulcers: Two longitudinal follow-up studies using a national sample cohort

Cocaine and Amphetamine Regulated Transcript (CART) Expression Changes in the Stomach Wall Affected by Experimentally Induced Gastric Ulcerations

Contact Info

Product

Resources

About