GCH1 Deficiency Activates Brain Innate Immune Response and Impairs Tyrosine Hydroxylase Homeostasis

Abstract

The Parkinson's disease (PD) risk gene GTP cyclohydrolase 1 (GCH1) catalyzes the ratelimiting step in tetrahydrobiopterin (BH4) synthesis, an essential cofactor in the synthesis of monoaminergic neurotransmitters. To investigate the mechanisms by which GCH1 deficiency may contribute to PD, we generated a loss of function zebrafish gch1 mutant (gch1 -/-), using CRISPR/Cas technology. gch1 -/zebrafish develop marked monoaminergic neurotransmitter deficiencies by 5 dpf, movement deficits by 8 dpf and lethality by 12 dpf.Tyrosine hydroxylase protein levels were markedly reduced without loss of ascending dopaminergic (DAergic) neurons. L-Dopa treatment of gch1 -/larvae improved survival without ameliorating the motor phenotype. RNAseq of gch1 -/larval brain tissue identified highly upregulated transcripts involved in innate immune response. Subsequent experiments provided morphological and functional evidence of microglial activation in gch1 -/-. The results of our study suggest that GCH1 deficiency may unmask early, subclinical parkinsonism and only indirectly contribute to neuronal cell death via immune-mediated mechanisms. Our work highlights the importance of functional validation for GWAS risk factors and further emphasises the important role of inflammation in the pathogenesis of PD.

Metabolic and Transcriptomic Changes in the Mouse Brain in Response to Short-Term High-Fat Metabolic Stress

“…Specifically, GCH1 mediates the rate-limiting step for the production of tetrahydrobiopterin (BH4), an essential cofactor required for the synthesis of monoaminergic neurotransmitters such as serotonin and dopamine [ 59 ]. GCH1 deficiency was recently shown to activate the innate immune response in the brain [ 60 ]. Furthermore, genes involved in immunity and infection [e.g., chemokine ligand 19 (ccl19), dedicator of cytokinesis 8 (DOCK8), and intercellular adhesion molecule-1 (ICAM-1)] [ 61 , 62 ] were also significantly dysregulated.…”

C9ORF72 deficiency results in degeneration of the zebrafish retinain vivo

“…All adult zebrafish were raised in standard conditions under project license PP5258250. The c9orf72 mutant line was generated using CRISPR/Cas9 as previously described 39,40 using standard Tracr RNA and a CrRNA targeting an mwo1 restriction enzyme site within exon 2 of the zebrafish c9orf72 (5’UAGAAGCUAAGCUCUGACUG), both purchased from Merck KGaA (Germany, Darmstadt). This complex was co-injected with Cas9 protein (M0386M, NEB, Ipswich USA) into the yolk of 1-cell stage WT zebrafish embryos.…”

“…The zebrafish has shown to be a promising complementary in vivo vertebrate model of neurodegeneration, demonstrating the key markers of pathology, including neuronal loss and gliosis, even during early larval stages, in models of various neurodegenerative conditions 22,[25][26][27][28][29][30][31][32] . Previous studies characterising c9orf72 deficient larval zebrafish utilised a knock down approach with Morpholinos 33 , and indicated that knockdown of c9orf72 in zebrafish resulted in axon outgrowth deficits in motor neurons and reduction in spontaneous movement 33 .…”

Ferroptosis is a new therapeutic target for spinal cord injury

“…The GTP cyclohydrolase-1-tetrahydrobiopterin (GCH1-BH4) pathway is a lipid antioxidant pathway independent of the Xc-GSH-GPX4 axis and the NADPH-FSP1-CoQ10 pathway ( Liu M. et al, 2022 ). GTP cyclohydrolase-1 (GTP Cyclohydrolase-1, GCH1) is a rate-limiting enzyme of BH4 ( Larbalestier et al, 2022 ). overexpression of GCH1 enhances the production of BH4 ( Kraft et al, 2020 ), a potent free radical-trapping antioxidant that protects cells from Ferroptosis by reducing lipid peroxidation ( Vasquez-Vivar et al, 2022 ; Figure 2 ).…”