Gene and Protein Sequence Optimization for High-Level Production of Fully Active and Aglycosylated Lysostaphin in Pichia pastoris

Abstract

e Lysostaphin represents a promising therapeutic agent for the treatment of staphylococcal infections, in particular those of methicillin-resistant Staphylococcus aureus (MRSA). However, conventional expression systems for the enzyme suffer from various limitations, and there remains a need for an efficient and cost-effective production process to facilitate clinical translation and the development of nonmedical applications. While Pichia pastoris is widely used for high-level production of recombinant proteins, there are two major barriers to the production of lysostaphin in this industrially relevant host: lack of expression from the wild-type lysostaphin gene and aberrant glycosylation of the wild-type protein sequence. The first barrier can be overcome with a synthetic gene incorporating improved codon usage and balanced A؉T/G؉C content, and the second barrier can be overcome by disrupting an N-linked glycosylation sequon using a broadened choice of mutations that yield aglyscosylated and fully active lysostaphin. The optimized lysostaphin variants could be produced at approximately 500 mg/liter in a small-scale bioreactor, and 50% of that material could be recovered at high purity with a simple 2-step purification. It is anticipated that this novel highlevel expression system will bring down one of the major barriers to future development of biomedical, veterinary, and research applications of lysostaphin and its engineered variants. L ysostaphin (LST) is a glycyl-glycine zinc-dependent endopeptidase natively encoded on the pACK1 plasmid of Staphylococcus simulans (1), an environmental competitor of Staphylococcus aureus. LST is synthesized as a preproenzyme of 493 amino acids, and its pre-(36 amino acids) and pro-(211 amino acids) sequences are removed during and after secretion, respectively. Mature LST is a monomer composed of an N-terminal catalytic domain (132 amino acids), a C-terminal cell wall binding domain (102 amino acids), and a short connecting linker (13 amino acids) between the two (2). The LST enzyme selectively and efficiently degrades pentaglycine cross-links in the peptidoglycan component of S. aureus cell walls, ultimately resulting in bacterial lysis and death. Lysostaphin was discovered in the 1960s (3) and has since undergone various degrees of preclinical development and even small-scale clinical testing by different groups and organizations (4-8). Early interest in LST as a therapeutic agent waned as a result of ready access to conventional drugs, such as methicillin, but enthusiasm for LST in biomedical applications has been revived due to wide-spread antibiotic resistance and shallow antimicrobial development pipelines (9).One barrier to LST clinical applications is the high doses required to eradicate some infections. LST appeared to show good efficacy in an unresponsive leukemia patient suffering from multidrug-resistant staphylococcal pneumonia, multiple abscesses, and cellulitis (7), but this effect required a 500-mg systemic bolus of enzyme. In another study, nasal carriers o...

Structure-based redesign of lysostaphin yields potent antistaphylococcal enzymes that evade immune cell surveillance

“…32 All PCR reactions were performed using Phusion ® High-Fidelity DNA polymerase. The lysostaphin gene harboring the desired mutations was digested with EcoRI and XhoI, and ligated into the pPIC9 plasmid using T4 DNA ligase.…”

Fusion with a cell wall binding domain renders autolysin LytM a potent anti-Staphylococcus aureus agent

“…For fusion constructs, the coding sequence for the ssLys cell wall binding domain (amino acids 385–493) was amplified by PCR from pRG5 (ATCC: 67076). The ssLys catalytic domain (ssLys ΔCWBD ) consisting of amino acids 248–400 (UniProt P10547) was amplified from a plasmid encoding a codon-optimized, aglycosylated, S126P point mutant (Zhao et al , 2014) using primers ATCGCTCGAGAAAAGAGCTGCTACCCACGAGCACTCCGCT and CGATGAATTCTTAGGTGTTTGGGGTTGGGGTGACGGT. The amplicon was cloned into the XhoI and EcoRI sites of vector pPIC9, transformed into DH5α and sequence verified.…”

“…The amplicon was cloned into the XhoI and EcoRI sites of vector pPIC9, transformed into DH5α and sequence verified. Sequence verified plasmid was linearized with SacI, transformed into Pichia pastoris strain GS115, and expressed and purified as described elsewhere (Zhao et al , 2014). Gene fusions were generated using splice overlap extension PCR of LytM 185-316 (5′-primer ACCATTCCATGGCGCATGCGAAAGAC and 3′-primer CTGCTTTTCCATATCCTGCTCTACTTTGCAAGTATGAC) and ssLys 385-493 (5′-primer GTCATACTTGCAAAGTAGAGCAGGATATGGAAAAGCAG and 3′ primer CTCGAATTCGGATCCTTACTTTATAGTTCCCCAAAGAACACC), either with or without the encoded GAGS linker.…”

Yeast synthetic biology for the production of recombinant therapeutic proteins

“…The expression of diphtheria toxin and human glucocerebrosidase in P. pastoris was improved by codon optimization and removal of an AT-rich region that caused early termination of transcription (Woo et al, 2002). A very recent study in P. pastoris further demonstrated the importance of codon optimization and balanced A+T/G+C content for the production of lysostaphin, a promising therapeutic agent for treating staphylococcal infections, particularly those caused by the methicillin-resistant Staphylococcus aureus (Zhao et al, 2014).…”