Gene Presence–Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure

Abstract

Gene presence–absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence–absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence–absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence–absence polymorphism in the two species. Genes displaying presence–absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence–absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence–absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies.

Congruent population genetic structures and divergence histories in anther‐smut fungi and their host plants Silene italica and the Silene nutans species complex

“…Strong host specialization may indeed play a role in reproductive isolation, through migrant inviability and hybrid maladaptation on parental hosts, especially given the life cycle of Microbotryum fungi, with many spores falling on a plant and competing for systemic infection, and selfing being frequent, exposing hybrids to systematic competition with nonhybrids (Gibson, Hood, & Giraud, 2012). In addition, comparative genomics of anther-smut fungi have shown the presence of large genomic rearrangements and gene content variation between species (Branco et al, 2018;Hartmann et al, 2018), and experimental crosses suggested a high frequency of hybrid sterility and abnormal genomic contents in hybrids (de Vienne, Refrégier, et al, 2009). McDonald, 2002;Saleh, Milazzo, Adreit, Fournier, & Tharreau, 2014;Stukenbrock, Banke, & McDonald, 2006;Zaffarano, McDonald, & Linde, 2008), in which patterns are heavily impacted by host genetic homogeneity and high abundance, as well as by human-mediated plant and pathogen dispersal.…”

“…We performed read mapping and SNP calling of the 109 analysed genomes against the MvSn‐1249‐A2 genome as previously described (Branco et al, 2018; Hartmann, Rodríguez de la Vega, Brandenburg, Carpentier, & Giraud, 2018). First, we trimmed Illumina raw reads for sequence quality and removed adapter sequences using the software cutadapt version 1.8.3 (Martin, 2011) with the options: ‐q 10, 10; –minimum‐length 50; ‐a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; ‐AAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATT.…”

“…We performed read mapping and SNP calling of the 109 analysed genomes against the MvSn-1249-A2 genome as previously described (Branco et al, 2018;Hartmann, Rodríguez de la Vega, Brandenburg, Carpentier, & Giraud, 2018). First, we…”

Differential gene expression is associated with degeneration of mating-type chromosomes in the absence of sexual antagonism

“…Transposable element (TE) annotation of both haploid genomes of M. lychnidis-dioicae was published previously [87], and was used for analysis in this study. The coding sequence of each gene from both a 1 and a 2 haploid genomes was search by BLAST(n) against the published annotated TE consensus sequences of the same species, and alignment >80 percent of query coverage (coding sequences) was used for identifications of TEs.…”

“…The TE annotation of the M. lychnidis-dioicae genome published previously [87] was used for the analysis in this study. First, the TE insertion sites were assessed for each given focal gene, upstream 0-5k, 5-10kb, 10-15kb, 15-20kb distance intervals, and downstream 0-5kb, 5-10kb, 10-15kb and 15-20kb distance intervals using Bedtools window function for each indicated distance window (https://bedtools.readthedocs.io/en/latest/content/tools/window.html).…”