Generation of acid resistant virus like particles of vaccine strains of foot-and-mouth disease virus (FMDV)

Deepak, Parakkal; Saravanan, P.; Biswal, Jitendra K.; Basagoudanavar, Suresh H.; Dechamma, H J; Umapathi, V.; Sreenivasa, B.P.; Tamilselvan, R.P.; Krishnaswamy, Narayanan; Zaffer, I.; Sanyal, Aniket

doi:10.1016/j.biologicals.2019.06.003

Cited by 4 publications

(6 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Following the reverse transcriptase procedure, amplification was conducted with a 12.5 μL mix consisting of 2× PCR Master mix Solution ( i -Taq) ( iNtRon, Gyeonggi-do, Republic of Korea), 1 μL of primer forward DHP13 (10 nmol; GTGACTGAACTGCTTTACCGCAT), 1 μL of primer reverse NK61 (10 nmol; GACATGTCCTCCTGCATCTG), 2.5 μL of nuclease-free water, and 3 μL of cDNA sample. The PCR reaction was performed using a Bioer Thermal cycler (Bioer Technology, Hangzhou, Japan) with the following temperature cycle: initial denaturation at 96°C for 30 s; 40 cycles of denaturation at 94°C for 15 s, annealing at 60°C for 30 s, and extension at 68°C for 30 s; and a final extension cycle at 68°C for 3 min [ 25 , 26 ]. Electrophoresis of PCR results was performed on 2% agarose gel with TBE1×(Promega) and RedSafe ( i NtRon, Gyeonggi-do, Republic of Korea) agarose gel dye.…”

Section: Methodsmentioning

confidence: 99%

Designing one-step reverse transcriptase loop-mediated isothermal amplification for serotype O foot-and-mouth disease virus detection during the 2022 outbreak in East Java, Indonesia

Aksono,

Lamid,

Rimayanti

et al. 2023

Vet World

View full text Add to dashboard Cite

Background and Aim: Various methods can detect foot-and-mouth disease (FMD) in cows, but they necessitate resources, time, costs, laboratory facilities, and specific clinical specimen submission, often leading to FMD virus (FMDV) diagnosis delays. The 2022 FMD outbreak in East Java, Indonesia, highlighted the need for an easy, inexpensive, rapid, and accurate detection approach. This study aims to devise a one-step reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technique and phylogenetic analysis to detect the serotype O FMDV outbreak in East Java. Materials and Methods: Swab samples were collected from the foot vesicles, nasal secretions, and saliva of five suspected FMDV-infected cows in East Java between June and July 2022. The RT-LAMP design used hydroxy naphthol blue dye or SYBR Green I dye, with confirmatory analysis through reverse transcriptase polymerase chain reaction (RT-PCR) targeting 249 base pairs. PCR products underwent purification, sequencing, and nucleotide alignment, followed by phylogenetic analysis. Results: The RT-LAMP method using hydroxy naphthol blue dye displayed a positive reaction through a color shift from purple to blue in the tube. Naked-eye observation in standard light or ultraviolet (UV) light at 365 nm, with SYBR Green I stain, also revealed color change. Specifically, using SYBR Green I dye, UV light at 365 nm revealed a color shift from yellow to green, signifying a positive reaction. Nucleotide alignment revealed mutations and deletion at the 15th sequence in the JT-INDO-K3 isolate from the East Java FMDV outbreak. Despite differing branches, the phylogenetic tree placed it in the same cluster as serotype O FMDV from Malaysia and Mongolia. Conclusion: JT-INDO-K3 exhibited distinctions from Indonesian serotype O FMDV isolates and those documented in GenBank. Then, the RT-LAMP method used in this study has a detection limit 10 times higher latter than the conventional RT-PCR limit, without any cross-reactivity among strains. Keywords: cow, East Java, foot-and-mouth disease virus, reverse transcriptase loop-mediated isothermal amplification, reverse transcriptase polymerase chain reaction, serotype O.

show abstract

Section: Methodsmentioning

confidence: 99%

Designing one-step reverse transcriptase loop-mediated isothermal amplification for serotype O foot-and-mouth disease virus detection during the 2022 outbreak in East Java, Indonesia

Aksono,

Lamid,

Rimayanti

et al. 2023

Vet World

View full text Add to dashboard Cite

show abstract

“…There are currently a significant number of research groups developing VLP-based vaccines against several viruses including the following: human cytomegalovirus, influenza, ,,, chikungunya, ,,− zika, dengue, duck tembusu, bluetongue, foot-and-mouth disease, , HIV-1, poliovirus, porcine circovirus type 2, human papilloma, and respiratory syncytial and zaire ebolavirus viruses. For example, influenza virus-based VLPs containing several Toxoplasma gondii proteins (IMC, ROP18, and MIC8) were assembled by coexpression with the M protein from the influenza virus.…”

Section: Vaccinesmentioning

confidence: 99%

“…Convection-enhanced delivery (CED) is a promising approach to achieve this goal. Multifunctional Qβ-based VLPs have been reported based on fluorescent protein and 68 Ga-DOTA as tracking agents and epirubicin (EPI) as chemotherapeutic agents and a cell-penetrating peptide. The system achieved a high drug payload and proper detection through fluorescence and PET imaging.…”

Section: Theragnostic Approachesmentioning

confidence: 99%

The Role of Virus-Like Particles in Medical Biotechnology

2020

View full text Add to dashboard Cite

Virus-like particles (VLPs) are protein-based, nanoscale, self-assembling, cage architectures, which have relevant applications in biomedicine. They can be used for the development of vaccines, imaging approaches, drug and gene therapy delivery systems, and in vitro diagnostic methods. Today, three relevant viruses are targeted using VLP-based recombinant vaccines. VLPbased drug delivery, nanoreactors for therapy, and imaging systems are approaches under development with promising outcomes. Several VLP-based vaccines are under clinical evaluation. Herein, an updated view on the VLP-based biomedical applications is provided; advanced methods for the production, functionalization, and drug loading of VLPs are described, and perspectives for the field are identified.

show abstract

“…Foot-and-mouth disease virus (FMDV), belonging to the genus Aphthovirus of the family Picornaviridae, is the causative pathogen of foot-and-mouth disease (FMD), an acute and contagious disease of clove-hoofed animals with devastating economic repercussions [20,21]. The genome of the FMDV encodes a large polyprotein that can be cleaved into 4 structural proteins (VP1-4) and several nonstructural proteins [20].…”

Section: Introductionmentioning

confidence: 99%

Hepatitis E Virus Capsid as a Carrier of Exogenous Antigens for the Development of Chimeric Virus-Like Particles

Behloul

Zhou

et al. 2021

Intervirology

View full text Add to dashboard Cite

Introduction: Virus-like particles (VLPs), self-assembled multiprotein structures, can stimulate robust immune responses due to their structural similarity to native virions that allow the presentation of multiple copies of the target epitopes. Utilizing VLPs as vaccine platforms to present exogenous antigens is a promising and challenging approach in the vaccine development field. This study investigates the potential of the truncated hepatitis E virus (HEV) capsid as a VLP platform to present foreign antigens. Methods: The S and M domains of the HEV capsid protein were selected as the optimal carrier (CaSM). The exogenous antigen Seq8 containing 3 neutralizing epitopes from 3 different foot-and-mouth disease virus (FMDV) strains was linked to the C-terminal of CaSM to construct a chimeric VLP (CaSM-Seq8). The chimeric particles were produced in Escherichia coli, and their morphology, physicochemical properties, antigenicity, and immunogenicity were analyzed. Results: Morphological analysis showed that CaSM-Seq8 self-assembled into VLPs similar to CaSM VLPs (∼26 nm in diameter) but smaller than native HEV virions. Further, the thermal stability and the resistance to enzymatic proteolysis of Seq8 were enhanced when it was attached to the CaSM carrier. The antigenicity analysis revealed a more robust reactivity against anti-FMDV antibodies when Seq8 was presented on CaSM particles. Upon injection into mice, FMDV-specific IgGs induced by CaSM-Seq8 appeared earlier, increased faster, and maintained higher levels for a longer time than those induced by Seq8 alone or the inactivated FMDV vaccine. Conclusion: This study demonstrated the potential of utilizing the truncated HEV capsid as an antigen-presenting platform for the development of chimeric VLP immunogens.

show abstract

Generation of acid resistant virus like particles of vaccine strains of foot-and-mouth disease virus (FMDV)

Cited by 4 publications

References 16 publications

Designing one-step reverse transcriptase loop-mediated isothermal amplification for serotype O foot-and-mouth disease virus detection during the 2022 outbreak in East Java, Indonesia

Designing one-step reverse transcriptase loop-mediated isothermal amplification for serotype O foot-and-mouth disease virus detection during the 2022 outbreak in East Java, Indonesia

The Role of Virus-Like Particles in Medical Biotechnology

Hepatitis E Virus Capsid as a Carrier of Exogenous Antigens for the Development of Chimeric Virus-Like Particles

Contact Info

Product

Resources

About