Genetic analysis and screening of detoxification-related genes in an amitraz-resistant strain of <i>Panonychus citri</i>

Yu, Shi-Jiang; Cong, Lin; Liu, Haoqiang; Chun, Ran

doi:10.1017/s0007485320000267

Cited by 10 publications

(8 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…At the level of the metabolic process, an insecticide can increase the rate of metabolism of another co‐administered insecticide. For example, in Carnolian honeybee workers ( Apis mellifera carnica ), sublethal concentrations of thymol caused an increase in the activity of the enzymes acetylcholinesterase (AChE) and glutathione S‐transferase (GST) (Glavan et al, 2020), while in an amitraz‐resistant strain of the citrus pest Panonychus citri , an increase in the expression of AchE was recorded by Real‐time PCR technique, indicating that this enzyme could be involved in the hydrolysis of amitraz (Yu et al, 2020). Additional studies should be conducted to determine if the enzyme AchE is involved in the metabolization of amitraz in T. infestans nymphs.…”

Section: Discussionmentioning

confidence: 99%

Lethal and repellent effect of amitraz, eugenol and thymol against Triatoma infestans, the main vector of Trypanosoma cruzi in the southern of America

Dadé

Daniele

Reyes‐Novelo

et al. 2023

Medical Vet Entomology

View full text Add to dashboard Cite

The lethal and repellent effect of the synthetic insecticide amitraz and the botanical insecticides eugenol and thymol separately and together in binary mixtures was tested against late‐stage nymphs of a susceptible strain of Triatoma infestans, the main vector of Trypanosoma cruzi, the etiological agent of Chagas disease, in the Southern Cone of America. For the lethality study, the LD50 was determined for each insecticide alone and in binary mixture by topical application. The combination index (CI) was established to quantify interactions occurring between the insecticides. The repellent effect was tested using the area preference technique. The lethal effect of amitraz was 11 and 34 times more potent than that of thymol and eugenol, respectively. Only the combination of eugenol and amitraz at high concentrations showed a synergistic effect (CI: 0.3). The repellent activity of monoterpenes after 30 min of exposure was significant at 780 and 78 μg/cm2 for eugenol and thymol, respectively. The residual repellent effect of eugenol lasted for one week at the concentrations of 1170 and 1560 μg/cm2, whereas thymol managed to retain its repellent effect for two weeks at concentrations of 1560 and 3900 μg/cm2.

show abstract

Section: Discussionmentioning

confidence: 99%

Lethal and repellent effect of amitraz, eugenol and thymol against Triatoma infestans, the main vector of Trypanosoma cruzi in the southern of America

Dadé

Daniele

Reyes‐Novelo

et al. 2023

Medical Vet Entomology

View full text Add to dashboard Cite

show abstract

“…It is worth noting that the ED value of EVM0004493 (1.55) gene is greater than EVM0003193 (1.41), which implies that the former has a stronger association with resistance trait. Previous genetic analysis of resistance indicated that multiple genes may be involved in the resistance of P. citri to amitraz, 74 so we cannot ignore the influence of other mutant genes in the candidate interval on the susceptibility of mites to amitraz, such as ABCC10 (EVM0006133) and transmembrane channel‐like protein (EVM0009492) etc . located on contig00033, which have a certain role in the transportation of heterologous compounds or ions.…”

Section: Discussionmentioning

confidence: 99%

“…A sufficient number of hybrid progenies (F) were transferred to the feeding device for culture. Based on a previous study, 74 the mites in the device were sprayed with 100 mg/L amitraz solutions. After 24 h, the dead mites were considered to be susceptible to amitraz.…”

Section: Methodsmentioning

confidence: 99%

“…After running, the differences of mRNA structure before and after mutation were analyzed. The expression of the target gene in the susceptible strain (SS) and resistant strain (RS) of P. citri was detected by real‐time fluorescent quantitative PCR as previously described 74 . The specific primers were F: TCAAGTGATTCGGGTTACGGG and R: CGGCACAGGCTAACGAGACAA, with an amplification length of 202 bp.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Whole genome sequencing and bulked segregant analysis suggest a new mechanism of amitraz resistance in the citrus red mite, Panonychus citri (Acari: Tetranychidae)

Cong

Pan

et al. 2021

Pest Management Science

Self Cite

View full text Add to dashboard Cite

BACKGROUND Amitraz is a broad‐spectrum insecticide/acaricide for the control of aphids, psyllids, ticks and mites. Current evidence suggests that ticks and phytophagous mites have developed strong resistance to amitraz. Previous studies have shown that multiple mechanisms are associated with amitraz resistance in ticks, but very few reports have involved Panonychus citri. We therefore used whole genome sequencing and bulked segregant analysis (BSA) to identify the mechanism underlying P. citri's resistance to amitraz. RESULTS High‐quality assembly of the whole P. citri genome was completed, resulting in a genome of approximately 83.97 Mb and a contig N50 of approximately 1.81 Mb. Gene structure predictions revealed 11 577 genes, of which 10 940 genes were annotated. Trait‐associated regions in the genome were mapped with bulked segregant analysis and 38 candidate SNPs were obtained, of which T752C had the strongest correlation with the resistant trait, located at the 5′ untranslated region (UTR) of the β‐2R adrenergic‐like octopamine receptor gene. The mutation resulted in the formation of a short hairpin loop structure in mRNA and gene expression was down‐regulated by more than 50% in the amitraz‐resistant strain. Validation of the T752C mutation in field populations of P. citri found that the correlation between the resistance ratio and the base mutation was 94.40%. CONCLUSION Our results suggest that this 5′ UTR mutation of the β‐2R octopamine receptor gene, confers amitraz resistance in P. citri. This discovery provides a new explanation for the mechanism of pest resistance: base mutations in the 5′ untranslated region of target gene may regulate the susceptibility of pests to pesticides.

show abstract

“…Panonychus citri (Acarina:Tetranychidae) is a spider mite with worldwide distribution and causes large economic losses in many countries [1,2]. The P.citrus has a stabbing mouthpiece and feeds on the juice from the leaves, shoots, ower buds, and fruits of Citrus [2,3].Currently, the main strategy for P.citrus control remains chemical control, however it has developed strong tolerance for many acaricides, such as pyridaben, fenpyroximate [4,5]. Therefore, it is necessary to select more effective insecticides for controlling this pest.…”

Section: Introductionmentioning

confidence: 99%

Sublethal Effects of Bifenazate on Biological Traits and Enzymatic properties in the Panonychus citri (Acari: Tetranychidae)

Wang

Xin

Wang

et al. 2021

Preprint

View full text Add to dashboard Cite

Panonychus citri, is a major citrus pest with a global distribution. But in Pest Management, the extensive use of insecticides has resulted in insecticide tolerance. Bifenazate, a novel acaricides with high biological activity against red mites, such as the T.urticae, P. citri. However, its sublethal effects on P. citri have not been reported. Therefore, in present study, P. citri exposed to sublethal concentration of bifenazate shows high biological activity, and causes great changes of population parameters and enzymatic activity. Life table technology was used to demonstrate sublethal effects on the growth and reproduction of P. citri. The results showed that the developmental duration of immature stage used sublethal concentration of bifenazate (LC10, LC30) were no difference than control. Nevertheless, compared with control group, the female adult duration, the fecundity and longevity were significantly decrease, but the pre-oviposition period was longer; In addition, the net reproductive rate (R0), the mean generation(T) were significantly decreased compared to those of the control, but the intrinsic rate of increase(r), the finite rate(λ) were decreased in LC30 group, however, the doubling time was increased with the increasing concentrations of bifenazate. Furthermore, Enzymatic tests showed that CAT, POD, and CarE activities were higher in LC10 and LC30 treatments than control. The SOD and GST activities were lower in LC30 treatment than control and LC10 treatment. Moreover, the CYP450 activity was decreased with the increasing concentrations of bifenazate. Based on these results, the sublethal concentration of bifenazate may have adverse effects on population growth of P. citri. This result provides certain significant guidance for the Pest Management. As well as that, further studies should be done to explore resistance mechanisms of P. citri exposure to a sublethal concentrations of bifenazate.

show abstract

Genetic analysis and screening of detoxification-related genes in an amitraz-resistant strain of Panonychus citri

Cited by 10 publications

References 37 publications

Lethal and repellent effect of amitraz, eugenol and thymol against Triatoma infestans, the main vector of Trypanosoma cruzi in the southern of America

Lethal and repellent effect of amitraz, eugenol and thymol against Triatoma infestans, the main vector of Trypanosoma cruzi in the southern of America

Whole genome sequencing and bulked segregant analysis suggest a new mechanism of amitraz resistance in the citrus red mite, Panonychus citri (Acari: Tetranychidae)

Sublethal Effects of Bifenazate on Biological Traits and Enzymatic properties in the Panonychus citri (Acari: Tetranychidae)

Contact Info

Product

Resources

About