Genetic differentiation in the threatened soft coral Dendronephthya australis in temperate eastern Australia

Abstract

The endangered soft coral Dendronephthya australis faces substantial population decreases in central eastern Australian waters. Despite uncertainty about the cause of these declines, the population genetics of the species has not been investigated. Genetic analysis suggests that D. australis is a single species within the family Nephtheidae, confirming identifications based on morphological characteristics only. Soft coral colonies were distributed from Seahorse Gardens in Port Stephens to Jervis Bay in temperate Australian waters, a distance of some 400 km. Genetic differentiation was observed along this distribution using SNP genotyping. Relatively high levels of genetic differentiation were observed between Jervis Bay and the other sites, indicating limited gene flow between this location and others. Moreover, the genetic distinctiveness, low diversity and heterozygote excess at this southern location suggested that it was subjected to a recent population decline and genetic bottleneck. Colonies at Seahorse Gardens and Ettalong, approximately 150 km south of Seahorse Gardens, displayed greater genetic diversity, making these sites more likely to host ancestral populations and to have acted as refugia. Recent substantial decreases in population sizes at these locations are particularly concerning, and these locations require immediate conservation attention.

La Niña Pushes an Endangered Temperate Soft Coral Species to the Brink of Localised Extinction

“…Without these clusters of colonies, their ability to reproduce may be hindered. Although there is evidence that D. australis can asexually propagate (Larkin et al 2023b), genetic analyses indicate that sexual reproduction is likely its primary mode of proliferation (Williamson et al 2022), as has been found for other Malacalcyonacean species (McFadden 1997;Bastidas et al 2001). A recent study provides evidence that D. australis is a gonochoric broadcast spawner (Larkin et al 2023b).…”

New Record of Dendronephthya sp. (Family: Nephtheidae) from Mediterranean Israel: Evidence for Tropicalization?

“…For species identification, three genetic markers were PCR-amplified. The mitochondrial marker ribosomal 16S gene was amplified using primers DN1-F (5′-AGGCTACTTAAGTATAGGGG-3’) and DN1-R (5′-AACTCTCCGACAATATTACGC-3′), with PCR conditions as described in [ 43 ]. The second markers were the oxidase subunits I and II (cox1 and 2), which were generated based on the available sequences of Dendronephthya hemprichi (native to the Red Sea) in NCBI at the time (GU355996.1): DhCox12F AGAGTGTTCTCACCTACTTTAG and DhCox12R GTTTAGCAGAAAATGTGGGTAT.…”

“…To date, species classification of the family Nephtheidae has mainly been based on morphology [ 42 ]. Recent phylogenetic analysis using a whole mitochondrial genome provides better resolution of the topology of this family [ 43 , 44 ]. However, further genetic information is required in order to resolve species-level phylogeny amongst genera in this family [ 42 , 45 ].…”

New record ofDendronephthya hemprichi(Family: Nephtheidae) from Mediterranean, Israel- an evidence for tropicalization?

“…For species identification, two genetic markers were PCR-amplified. The mitochondrial marker ribosomal 16S gene was amplified using primers DN1-F (5'-AGGCTACTTAAGTATAGGGG-3') and DN1-R (5'-AACTCTCCGACAATATTACGC-3'), with PCR conditions described in (Williamson et al, 2022). The second marker was the oxidase subunit II and I (cox1 and 2) which were generated based on the available sequences of Dendronephthya hemprichi (native to the Red Sea) in NCBI at the time (GU355996.1), DhCox12F AGAGTGTTCTCACCTACTTTAG, DhCox12R GTTTAGCAGAAAATGTGGGTAT.…”