Genetic, epigenetic and pharmacological influences modulating tissue specific regulation of the cannabinoid receptor-1 gene (CB₁); implications for cannabinoid pharmacogenetics

Abstract

3 | P a g e 4 | P a g e Plasmid constructs.pCNR1prom-Luc. The human genomic fragment containing the CNR1 promoter (CNR1 prom) was amplified from human placental DNA using the following primers (9):CNR1prom for; 5'-GATAACCTTTTCTAACCACCCACCTAG-3', CNR1prom rev. 5'-GCGGAAAAGAAGTGGAGAAG-3' and cloned into the EcoRI and SacI restriction sites to replace the generic TATA box promoter of the pGL4.23 luciferase reporter construct to create the pCNR1prom-Luc (Fig 2A).pECR1C/TLuc. The ECR1 enhancer sequence was also recovered from pGEM-T easy (Nicoll et al 2012) and the minor T allele of ECR1 was re-created using site-directed mutagenesis where the template DNA was a previously established pECR1(C)Gem-Teasy construct, primers for sitedirected mutagenesis were:Production of pECR1(C)CNR1promLuc and pECR1(T)CNR1promLuc firefly luciferase reporter constructs was achieved by cloning the ECR1(C) or ECR1(T) regions from the pGEM-Teasy parent constructs using AatII and SalI sites and ligating into AatII and XhoI sites of the pCNR1prom luciferase construct, placing ECR1(C) or ECR1(T) upstream of the CNR1prom fragment to form pECR1C/TLuc (Fig 2A) pCNR1prom-LacZ. pCNR1prom was recovered from pCNR1promLuc and cloned into the NotI and SpeI sites of the LacZ reporter plasmid p1229 (10).pCNR1promLucCpG free. A CpG dinucleotide-free version of the CNR1prom-Luc reporter plasmid was created using the pCpGL-basic reporter plasmid (Klug and Rehli, 2006) and cloning the CNR1prom fragment from pCNR1promLuc reporter using BglII and NcoI sites. Plasmid methylation;Subsequently, 5μg of pCNR1promLucCpG free plasmid was methylated in a reaction containing 1x NEB buffer 2, 640μM SAM and 20U M.Sss1 enzyme (New England Biolabs) at 37°C followed by inactivation (65°C, 20mins) at various time points up to 1 hour (Full methylation). Levels of methylation were monitored using digestion by the HpaII enzyme that is

An ancient polymorphic regulatory region within the BDNF gene associated with obesity modulates anxiety-like behaviour in mice and humans

“…and CAS9 mRNA into 1-cell C57BL/6 mouse embryos as previously described (Hay et al, 2020;Hay et al, 2019;McEwan et al, 2020a;McEwan et al, 2020b). We were able to generate a single heterozygous female animal (BE5.1KO +/-) which was outbred on a C57BL/6 background for two generations to produce a colony of heterozygous male and female BE5.1 KO animals.…”

“…Single guide RNA (sgRNA) molecules were designed to disrupt the BE5.1 using the optimised CRISPR design tool (http://CRISPR.mit.edu/). sgRNA template was produced by annealing oligonucleotides to produce two different DNA templates using the annealed oligo template (AOT) method as previously described (Hay et al, 2019) that included a T7 polymerase binding site and predicted guide sequence target sites spanning the conserved region surrounding the BE5.1 enhancer (5'sgRNA; AACCCACTATAGCCCCCATGG and 3'sgRNA; TGGTTGCTGGCCCTCAGGTGG).…”

“…to determine differential changes in BDNF splice forms using a Roche Light Cycler 480 with Roche SYBR green (Shanley et al, 2010;Shanley et al, 2011) normalised against the Non-POU Domain Containing Octamer Binding protein (Nono) housekeeping gene as previously described (Hay et al, 2020;Hay et al, 2019;McEwan et al, 2020a;McEwan et al, 2020b). .…”

“…Instead, our approach used a combination of evolutionary conservation and GWAS study association to identify a candidate enhancer element within BNDF with possible role in human disease susceptibility. We have demonstrated on many occasions that enhancers demonstrating high levels of tissue-specificity are often highly conserved through evolution (Davidson et al, 2011;Davidson et al, 2006;Hay et al, 2020;Hay et al, 2019;McEwan et al, 2021;McEwan et al, 2020a;Miller et al, 2007;Miller et al, 2008;Nicoll et al, 2012;Shanley et al, 2010). Furthermore, review of literature from other labs relating to well characterised enhancers also describe high degrees, and depth, of conservation (Lettice et al, 2017;Long et al, 2020;Oldridge et al, 2015;Tuvikene et al, 2021).…”

Perspective: Quality Versus Quantity; Is It Important to Assess the Role of Enhancers in Complex Disease from an In Vivo Perspective?

“…For example, the GAL5.1 enhancer contains two loci that modulate its cell-type-specific activity such that the GG haplotype has one more CpG than the rarer CA haplotype [ 60 , 61 ]. Moreover, the enhancer within CNR1 intron 2 contains an SNP whose disease-associated T-allele removes a CpG [ 78 , 79 ]. From these preliminary observations, we can already see that polymorphic enhancer and promoter regions may serve as regions of the genome where genetics and environment interact to ensure health or to exacerbate disease susceptibility.…”