Genetic Fingerprinting of Wheat and Its Progenitors by Mitochondrial Gene orf256

Abstract

orf256 is a wheat mitochondrial gene associated with cytoplasmic male sterility (CMS) that has different organization in various species. This study exploited the orf256 gene as a mitochondrial DNA marker to study the genetic fingerprint of Triticum and Aegilops species. PCR followed by sequencing of common parts of the orf256 gene were employed to determine the fingerprint and molecular evolution of Triticum and Aegilops species. Although many primer pairs were used, two pairs of orf256 specific primers (5:-94/C: 482, 5:253/C: 482), amplified DNA fragments of 576 bp and 230 bp respectively in all species were tested. A common 500 bp of nine species of Triticum and Aegilops were aligned and showed consistent results with that obtained from other similar chloroplast or nuclear genes. Base alignment showed that there were various numbers of base substitutions in all species compared to S. cereal (Sc) (the outgroup species). Phylogenetic relationship revealed similar locations and proximity on phylogenetic trees established using plastid and nuclear genes. The results of this study open a good route to use unknown function genes of mitochondria in studying the molecular relationships and evolution of wheat and complex plant genomes.

Drought Stress Tolerance and Photosynthetic Activity of Alloplasmic Lines T. dicoccum x T. aestivum

“…To analyze the inheritance of parental mtDNA types, we used polymerase chain reaction (PCR) markers both own and taken from literary sources for two unique genes of mitochondrial genome, orf256, rps19-p [19,20]. Figure 2 shows the result of restriction endonuclease Taq I-digestion of PCR products obtained using the combination of primers orf256f/orf256r.…”

“…The following genes were used for the analysis of mtDNA of alloplasmic lines: 1) orf 256-chimeric reading frame near the cytochrome oxidase gene (associated with cytoplasmic male sterility (CMS) [19]; 2) rps19-ppseudogene encoding a ribosomal protein [20]. Corresponding primer pairs for each gene were the following: orf256f (ggaagggaaccaatcaagtcacc)/orf256r (gatcctgctcgtaaaggctcag); rps19f (tgctccgtactcatttacaatgg)/rps19r (atagggtcttcgtctccgtg).…”

Leaf Rust Resistance and Molecular Identification of Lr 34 Gene in Egyptian Wheat

“…Finally, T. aestivum is hexaploid with a genome constitution of AABBDD, and was formed about 8,000 years ago from hybridization between T. turgidum (AABB) and A. tauschii (DD) [37]. Also, cslV34 marker is very specific for T. aestivum and D genome progenitor A. tauschii [11].…”

Наследование генов-маркеров к митохондриальной ДНК у аллоплазматических линий T. dicoccum x T. aestivum

“…ДНК выделяли из 7-дневных проростков согласно стандартной методике с бисульфитом натрия. В качестве маркеров генов митохондриальной ДНК использовали следующие комбинации праймеров (условия ПЦР даны в соответствующих статьях): 1) orf256f: ggaagggaaccaatcaagtcacc; orf256r: gatcctgctcgtaaaggctcag [3]; 2) rps19f: tgctccgtactcatttacaatgg; rps19r: atagggtcttcgtctccgtg [4]. В случае orf256 продукты ПЦР обрабатывали рестрикционной эндонуклеазой Taq I (Сибэнзим, Новосибирск) с последующим электрофорезом (CAPS-маркер).…”