Genetic Heterogeneity of Mumps Virus in the United Kingdom: Identification of Two New Genotypes

Abstract

A reverse transcriptase nested polymerase chain reaction (PCR) was developed to detect the small hydrophobic (SH) gene of mumps virus (MuV). Phylogenetic analysis was performed on the entire SH gene sequence (318 nucleotides) and the putative SH protein (57 amino acids). At least 4 MuV genotypes were identified in the United Kingdom between 1995 and 1998 by direct sequencing of 26 PCR amplicons from a variety of specimens. Comparison of these and GenBank sequences identified 2 new genotypes in the United Kingdom. The results suggest that, after the introduction of universal mumps vaccination in the United Kingdom in 1988, there appears to have been a switch from a predominant genotype to a heterogeneous group of strains.

Characterization of Mumps Virus Isolated in Saitama Prefecture, Japan, by Sequence Analysis of the SH Gene

“…Genotype G strains were first reported from the United Kingdom and Nepal (UK/Nepal) by Jin et al (4). They also reported Genotype H strains from the United Kingdom (4). To the best of our knowledge, this is the first report of the two genotypes (G and H) in Japan.…”

“…Compared with other strains from the UK, Loug1/UK97 (J) showed a higher similarity to Gloul/UK96 (G) than to SA967/Ja99 and TK087/Ja97 (J) at the amino acid level. Relatively low divergence at the amino acid level has been observed between different genotypes (C and E, D and G) (4). On the other hand, a high divergence at the amino acid level among strains of a single genotype (B) has been reported by Orvell et al (8).…”

“…Orvell et al analyzed the SH gene nucleotide sequences of MuV isolates from USA, Europe, and Japan and suggested that these strains formed five genotypes A to E (8). Recent studies proposed new genotypes F from China, G from the United Kingdom and Nepal, H from the United Kingdom, and I from Korea (15,4,6 (10,5). Based on their studies, we suspected that the MuV epidemic and recent outbreaks in Japan might be caused by previously unreported strains and that co-circulation of different lineages may occur.…”

“…Then cDNA transcripts were produced from extracted RNA using AMV reverse transcriptase (Seikagaku Corporation, Tokyo) and random primers (dN9) (Takara Shuzo, Co., Ltd., Shiga, Japan). For PCR amplification, the primers SHI (5/AGTAGTGTCGATGATCTCAT) and SH2R (5/GCTCAAGCCTTGATCATTGA) were used as described previously by Jin et al (4). PCR amplification was performed as follows: After denaturation for 5 min at 95 C, 30 cycles of 1 min at 95 C, 1.5 min at 50 C, 2 min at 72 C, and a final extension for 15 min at 72 C.…”

Phylogenetic Analysis of the Small Hydrophobic (SH) Gene of Mumps Virus in Korea: Identification of a New Genotype

“…The SH gene sequence has proven to be useful to identify the virus and estimate genetic lineages among mumps isolates. Phylogenetic analyses of the nucleotide sequences of the SH gene from different mumps virus isolates around the world including Japan, China, Europe and U.S.A., have shown the existence of five genotypes, which have been named A to E (7,9,15), and the existence of other genotypes (F, G and H) has been reported (5,11,14) Patients in whom classical mumps develops have bilateral or less commonly unilateral parotitis. Parotitis may be preceded by fever, headache, malaise, myalgia, and anorexia.…”