Genetic mapping of the Cre8 locus for resistance against cereal cyst nematode (Heterodera avenae Woll.) in wheat

Abstract

The cereal cyst nematode (CCN, Heterodera avenae Woll.) resistance locus Cre8 on the long arm of chromosome 6B (6BL) of wheat (Triticum aestivum L.) is effective in lowering the nematode population in soil. Identification of reliable and highthroughput molecular markers linked to the Cre8 locus is important for the successful deployment of Cre8-derived resistance in wheat breeding programs. Here, we report the addition of over 600 markers to improve an existing linkage map for the Trident/Molineux wheat population. With the improved map, Cre8 was mapped as a large-effect quantitative trait locus (QTL) near the distal end of 6BL. This QTL explained up to 35 % of the phenotypic variation in CCN resistance. New marker assays were developed for DNA polymorphisms in the Cre8 region. Seven molecular markers closely linked with Cre8 (at 0.9, 2.2 or 5.9 cM from the estimated QTL position) were found to be diagnostic across a panel of wheat cultivars and are recommended for use in marker-assisted selection of the Cre8 resistance locus in wheat breeding. Prospects for the isolation of the causal gene are discussed.

Genome-wide association study in hexaploid wheat identifies novel genomic regions associated with resistance to root lesion nematode (Pratylenchus thornei)

“…Previously a QTL, associated with susceptibility, was also identified between 60 and 67 cM on chromosome 1B region 80 . QTL/marker on chromosome 1B was also detected for another root-lesion nematode P. neglectus and cereal cyst nematode H. avenae 42,82,83 .…”

Genetic variation of bread wheat accessions in response to the cereal cyst nematode, Heterodera filipjevi

“…Catalase is one of the most important enzymes that remove hydrogen peroxide. Increased activity of this enzyme promotes plant resistance to stress conditions and, thus, increases the yield of the product (Jayatilake et al, 2015). Infection of resistant wheat lines to H. avenae resulted in a hypersensitive reaction, with syncytial cells deteriorating in a few days.…”

“…To amplify the Cre3 and catalase (Cat) sequences, a cultivar was selected from each cluster, according to the dendrogram obtained from the SSR markers, including 'Pishtaz' (moderately resistant; MR), 'Sirvan' (moderately susceptible; MS), 'Back Cross Roshan' (susceptible; S), 'Ohadi' and 'Homa' (highly susceptible; HS). The respective specific primers, forward: GATGTGA GATGCGCCAATT, reverse: TCTGCCACCCACAACT TAAG and forward: GCTATTTCATCCCCTTCTGC, reverse: GGGCCAAAGACTCGAAACA, that can recognise the putative disease resistance (RPP13)-like protein and catalase in wheat, were used (Ermishev et al, 2001;Jayatilake et al, 2015;Li et al, 2015).…”

Fine mapping of Rha2 in barley reveals candidate genes for resistance against cereal cyst nematode

“…Genes for resistance against cyst nematodes have been isolated from dicot species (Cai et al 1997 ; Liu et al 2012 , 2017 ; Paal et al 2004 ; van der Vossen et al 2000 ), but not from any monocot species. In barley (reviewed below) and in wheat (reviewed by Jayatilake et al 2015 ), resistance loci have been genetically mapped and resistance alleles have been used in cereal breeding. In Australia, where there is thought to be only one pathotype (Ha13) of H. avenae , consistent use of resistant cereal cultivars and cultural management practices has been very effective in reducing nematode populations in agricultural soils and preventing yield losses (Murray and Brennan 2010 ).…”