Genetic modifiers of the phenotype of mice deficient in mitochondrial superoxide dismutase

Abstract

Sod2-/- mice, which are deficient in the mitochondrial form of superoxide dismutase (MnSOD), have a short survival time that is strongly affected by genetic background. This suggests the existence of genetic modifiers that are capable of modulating the degree of mitochondrial oxidative damage caused by the MnSOD deficiency, thereby altering longevity. To identify these modifier(s), we generated recombinant congenic mice with quantitative trait loci (QTL) containing the putative genetic modifiers on the short-lived C57BL/6J genetic background. MnSOD deficient C57BL/6J mice with a QTL from the distal region of chromosome 13 from DBA/2J were able to survive for as long as those generated on the long-lived DBA/2J background. Within this region, the gene encoding nicotinamide nucleotide transhydrogenase (Nnt) was found to be defective in C57BL/6J mice, and no mature NNT protein could be detected. The forward reaction of NNT, a nuclear-encoded mitochondrial inner membrane protein, couples the generation of NADPH to proton transport and provides NADPH for the regeneration of two important antioxidant compounds, glutathione and thioredoxin, in the mitochondria. This action of NNT could explain its putative protective role in MnSOD-deficient mice.

Accelerated aging phenotype in mice with conditional deficiency for mitochondrial superoxide dismutase in the connective tissue

“…The studied mutant mice are on a mixed background derived from C57BL ⁄ 6J and SV129 ⁄ ola inbred strains. Interestingly, genetic modifiers of lifespan of mice deficient in Sod2 have earlier been reported (Huang et al, 2006). The gene encoding nicotinamide nucleotide transhydrogenase (Nnt) was found to be one of such modifiers in the C57BL ⁄ 6J mice, where this gene is mutated and functional Nnt protein could not be detected.…”

“…Nnt is a nuclear encoded mitochondrial inner membrane protein which couples the generation of NADPH to proton transport and provides NADPH for the generation of two important antioxidants (glutathione and thioredoxin) in the mitochondria. If non-functional as in the C57BL ⁄ 6J background, the mutant Nnt could contribute to the lifespan shortening in Sod2-deficient mice (Huang et al, 2006). To test the possibility that the early dying mutants in our study reveal a mutation in the Nnt gene, we systematically screened for this mutation.…”

Reduced mitochondrial SOD displays mortality characteristics reminiscent of natural aging

“…While it is hard to reconcile this difference since catalase overexpression can extend the life span in mice (Schriner et al, 2005) but it is proposed recently that oxidative stress theory of aging can be better established in Drosophila than in mice (Muller et al, 2007). Considering the fact that certain strains of mice carries genetic modifier(s) like Nicotinamide Nucleotide Transhydrogenase which can positively influence the life span of Sod2 −/− mice due to its mitochondrial antioxidant activity (Huang et al, 2006), it will be interesting to see if similar genetic modifier(s) might influence the life span of Sod2 +/− mice as well. We now know that the life span of Sod2 n283 remains uninfluenced in different genetic backgrounds (Duttaroy lab unpublished) nullifying the possibility of similar genomic modifiers in the Drosophila genome.…”

Rat insulin promoter 2-Cre recombinase mice bred onto a pure C57BL/6J background exhibit unaltered glucose tolerance

“…PCR analysis of regions corresponding to exons 8 and 11 in the nicotinamide nucleotide transhydrogenase (Nnt) gene PCR was performed on genomic DNA from either islets or tail tips from RIP2-Cre, WT littermates, C57BL/6J, and NMRI mice, using primers specific for exon 8 (Nnt exon 8 fwd primer: CCAGGCGAGCACTCTCTATT and rev primer: CAGGGTCACAGGAGAACACA) and exon 11 (Nnt exon 11 fwd primer: TCCTGCTATTCCTCCTCCTG and rev primer: GCTGCCTTGACTTTGGATATT) in the nnt gene as previously described (Freeman et al 2006, Huang et al 2006. Tail tips were digested with proteinase K (Ambion, Austin, TX, USA) as previously described (Kulkarni et al 1999, Silva et al 2000, Ristow et al 2003 and total DNA was extracted from islets (Qiagens DNeasy blood and tissue kit).…”