Genetic Reprogramming of the Ergot Alkaloid Pathway of Metarhizium brunneum

Abstract

Ergot alkaloids are important fungal specialized metabolites that are used to make potent pharmaceuticals for neurological diseases and disorders. Lysergic acid (LA) and dihydrolysergic acid (DHLA) are desirable lead compounds for pharmaceutical semi-synthesis but are typically transient intermediates in the ergot alkaloid and dihydroergot alkaloid pathways. Previous work with Neosartorya fumigata demonstrated strategies to produce these compounds as pathway end products, but their percent yield (percentage of molecules in product, as opposed to precursor, state) was low. Moreover, ergot alkaloids in N. fumigata are typically retained in the fungus as opposed to being secreted. We used CRISPR-Cas9 and heterologous expression approaches to engineer these compounds in Metarhizium brunneum, representing an alternate expression host from a different lineage of fungi. The relative percent yields of LA (86.9%) and DHLA (72.8%) were much higher compared to those calculated here for previously engineered strains of N. fumigata (2.6% and 2.0%, respectively). Secretion of these alkaloids also was measured, with an average 98.4% of LA and 87.5% of DHLA being secreted into the growth medium; both values were significantly higher than those measured for the N. fumigata derivatives (both of which were less than 5.6% secreted). We used a similar approach to engineer a novel dihydroergot alkaloid in M. brunneum and, through high performance liquid chromatography-mass spectrometry analyses (LC-MS), provisionally identified it as the dihydrogenated form of lysergic acid α-hydroxyethylamide (LAH). The engineering of these strains provides a strategy for producing novel and pharmaceutically important chemicals in a fungus more suitable for their production. IMPORTANCE Ergot alkaloids derived from LA or DHLA are the bases for numerous pharmaceuticals with applications in the treatment of dementia, migraines, hyperprolactinemia, and other conditions. However, extraction of ergot alkaloids from natural sources is inefficient, and their chemical synthesis is expensive. The ability to control and redirect ergot alkaloid synthesis in fungi may allow for more efficient production of these important chemicals and facilitate research on novel derivatives. Our results show that Metarhizium brunneum can be engineered to efficiently produce and secrete LA and DHLA, and also to produce a novel derivative of DHLA not previously found in nature. The engineering of dihydroergot alkaloids, including a novel species, is important because very few natural sources of these compounds are known. Our approach establishes a platform with which to use M. brunneum to study production of other ergot alkaloids, specifically those classified as lysergic acid amides and dihydroergot alkaloids.

Non-Transgenic CRISPR-Mediated Knockout of Entire Ergot Alkaloid Gene Clusters in Slow-Growing Asexual Polyploid Fungi

“…As commercial sources have recently made Cas9-NLS fusion proteins and synthetic sgRNAs available, a variety of approaches that include Cas9-sgRNA RNPs have been employed in fungi. Most involve the integration of a stable selectable marker [ 30 ] or simultaneous generation of a selectable mutation [ 8 ]. Khan et al [ 31 ] report using the Cas9-sgRNA RNP system without selection to target the TOX3 effector gene in Parastagonospora nodorum , with all of the six analyzed “transformants” exhibiting mutations at the repair site.…”

Contribution of a novel gene to lysergic acid amide synthesis in Metarhizium brunneum

“…The easP locus of M. brunneum was knocked out via a transient CRISPR/Cas9-mediated approach based on the protocol described by Davis et al [ 14 ]. An sgRNA was synthesized from the template 5′-TTCTAATACGACTCACTATAG TCTGCTCCATGGAGGCTCCT GTTTTAGAGCTAGA-3′ (the 20-nt target sequence is underlined and an additional G was inserted immediately preceding the target sequence) with the EnGen sgRNA synthesis kit (New England Biolabs, Ipswich, MA, USA).…”

“…An sgRNA was synthesized from the template 5′-TTCTAATACGACTCACTATAG TCTGCTCCATGGAGGCTCCT GTTTTAGAGCTAGA-3′ (the 20-nt target sequence is underlined and an additional G was inserted immediately preceding the target sequence) with the EnGen sgRNA synthesis kit (New England Biolabs, Ipswich, MA, USA). The sgRNA was complexed with EnGen Spy Cas9 NLS (New England Biolabs) and co-transformed into protoplasts along with a phosphinothricin-resistance conferring fragment [ 14 ]. Transformants were screened for mutations at easP in PCRs primed with oligonucleotides PcrspF (5′-CACACTCTACTCCCTCACAAGG-3′) and PcrspR (5′-CCGCTCCAGGCATCGTCAC-3′).…”

ERGOT Claviceps purpurea (Fries) Tulasne ALKALOID DIVERSITY AND VIRULENCE: EVOLUTION, GENETIC DIVERSIFICATION, AND METABOLIC ENGINEERING (review)

“…Среди способов получения рекомбинантных штаммов-продуцентов спорыньи отметим технологию геномного редактирования CRISPR/Cas9 (7,86,87), полиэтиленгликоль (PEG)-опосредованную трансформацию (7,88), агробактериальную трансформацию с использованием Agrobacterium tumefaciens (ATMT) (27). Совершенствование методов генной инженерии, основанных на гомологичной рекомбинации (HR) (89)(90)(91), позволяет с достаточно высокой эффективностью получать дизайнерские линии спорыньи (8,47) и организмов-гетерологов (73), в том числе с повышенным уровнем синтеза целевых алкалоидов (8,73).…”

“…К л а с т е р г е н о в б и о п р о д у к ц и и а л к а л о и д о в. О кластерной организации генов биосинтеза алкалоидов у спорыньи впервые сообщили в 1999 году, и в частности было показано значение гена dmaW для биосинтеза (8,102). Кластеры генов биосинтеза эргоалкалоидов обнаружены у различных грибов (30), например у Clavicipitaceae (30,103,104), в частности у Claviceps (30,102,103), Epichloe (20,30), Periglandula (3), Metarhizium brunneum (86,105), Neotyphodium lolli (106), Balansia cyperi, Balansia obtecta (30); у Aspergillus (107,108), в частности у Aspergillus fumigatus (107,110), A. leporis, A. homomorphus, A. hancockii (111) и A. japonicus (112,113); у Clavulinopsis fusiformis (106); у Arthroderma benhamiae (114,115); у Penicillium camemberti и Penicillium biforme (116).…”